ID: 991021803

View in Genome Browser
Species Human (GRCh38)
Location 5:61987196-61987218
Sequence AGTGATAGCTTAGTCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991021803_991021807 13 Left 991021803 5:61987196-61987218 CCTGAGCTGACTAAGCTATCACT No data
Right 991021807 5:61987232-61987254 TCCAAAATCTCATGTACTGTGGG No data
991021803_991021811 22 Left 991021803 5:61987196-61987218 CCTGAGCTGACTAAGCTATCACT No data
Right 991021811 5:61987241-61987263 TCATGTACTGTGGGGATTGAGGG No data
991021803_991021806 12 Left 991021803 5:61987196-61987218 CCTGAGCTGACTAAGCTATCACT No data
Right 991021806 5:61987231-61987253 TTCCAAAATCTCATGTACTGTGG No data
991021803_991021809 14 Left 991021803 5:61987196-61987218 CCTGAGCTGACTAAGCTATCACT No data
Right 991021809 5:61987233-61987255 CCAAAATCTCATGTACTGTGGGG No data
991021803_991021810 21 Left 991021803 5:61987196-61987218 CCTGAGCTGACTAAGCTATCACT No data
Right 991021810 5:61987240-61987262 CTCATGTACTGTGGGGATTGAGG No data
991021803_991021812 29 Left 991021803 5:61987196-61987218 CCTGAGCTGACTAAGCTATCACT No data
Right 991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991021803 Original CRISPR AGTGATAGCTTAGTCAGCTC AGG (reversed) Intergenic
No off target data available for this crispr