ID: 991021806

View in Genome Browser
Species Human (GRCh38)
Location 5:61987231-61987253
Sequence TTCCAAAATCTCATGTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991021803_991021806 12 Left 991021803 5:61987196-61987218 CCTGAGCTGACTAAGCTATCACT No data
Right 991021806 5:61987231-61987253 TTCCAAAATCTCATGTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991021806 Original CRISPR TTCCAAAATCTCATGTACTG TGG Intergenic
No off target data available for this crispr