ID: 991021806 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:61987231-61987253 |
| Sequence | TTCCAAAATCTCATGTACTG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 991021803_991021806 | 12 | Left | 991021803 | 5:61987196-61987218 | CCTGAGCTGACTAAGCTATCACT | No data | ||
| Right | 991021806 | 5:61987231-61987253 | TTCCAAAATCTCATGTACTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 991021806 | Original CRISPR | TTCCAAAATCTCATGTACTG TGG | Intergenic | ||
| No off target data available for this crispr | |||||