ID: 991021808

View in Genome Browser
Species Human (GRCh38)
Location 5:61987233-61987255
Sequence CCCCACAGTACATGAGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991021808_991021815 29 Left 991021808 5:61987233-61987255 CCAAAATCTCATGTACTGTGGGG No data
Right 991021815 5:61987285-61987307 ATGCCGGAAACAGGCATTTGAGG No data
991021808_991021813 13 Left 991021808 5:61987233-61987255 CCAAAATCTCATGTACTGTGGGG No data
Right 991021813 5:61987269-61987291 GGATCTTAAATTATTGATGCCGG No data
991021808_991021812 -8 Left 991021808 5:61987233-61987255 CCAAAATCTCATGTACTGTGGGG No data
Right 991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG No data
991021808_991021816 30 Left 991021808 5:61987233-61987255 CCAAAATCTCATGTACTGTGGGG No data
Right 991021816 5:61987286-61987308 TGCCGGAAACAGGCATTTGAGGG No data
991021808_991021814 20 Left 991021808 5:61987233-61987255 CCAAAATCTCATGTACTGTGGGG No data
Right 991021814 5:61987276-61987298 AAATTATTGATGCCGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991021808 Original CRISPR CCCCACAGTACATGAGATTT TGG (reversed) Intergenic
No off target data available for this crispr