ID: 991021811

View in Genome Browser
Species Human (GRCh38)
Location 5:61987241-61987263
Sequence TCATGTACTGTGGGGATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991021803_991021811 22 Left 991021803 5:61987196-61987218 CCTGAGCTGACTAAGCTATCACT No data
Right 991021811 5:61987241-61987263 TCATGTACTGTGGGGATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991021811 Original CRISPR TCATGTACTGTGGGGATTGA GGG Intergenic
No off target data available for this crispr