ID: 991021812

View in Genome Browser
Species Human (GRCh38)
Location 5:61987248-61987270
Sequence CTGTGGGGATTGAGGGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991021808_991021812 -8 Left 991021808 5:61987233-61987255 CCAAAATCTCATGTACTGTGGGG No data
Right 991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG No data
991021803_991021812 29 Left 991021803 5:61987196-61987218 CCTGAGCTGACTAAGCTATCACT No data
Right 991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991021812 Original CRISPR CTGTGGGGATTGAGGGAGAT TGG Intergenic
No off target data available for this crispr