ID: 991032149

View in Genome Browser
Species Human (GRCh38)
Location 5:62094056-62094078
Sequence GGGGTGGGGACGAACATGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991032149_991032157 -2 Left 991032149 5:62094056-62094078 CCTAGCATGTTCGTCCCCACCCC No data
Right 991032157 5:62094077-62094099 CCACACTCTCCTGTTGCCATGGG No data
991032149_991032155 -3 Left 991032149 5:62094056-62094078 CCTAGCATGTTCGTCCCCACCCC No data
Right 991032155 5:62094076-62094098 CCCACACTCTCCTGTTGCCATGG No data
991032149_991032159 12 Left 991032149 5:62094056-62094078 CCTAGCATGTTCGTCCCCACCCC No data
Right 991032159 5:62094091-62094113 TGCCATGGGAGCAGAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991032149 Original CRISPR GGGGTGGGGACGAACATGCT AGG (reversed) Intergenic
No off target data available for this crispr