ID: 991032157

View in Genome Browser
Species Human (GRCh38)
Location 5:62094077-62094099
Sequence CCACACTCTCCTGTTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991032148_991032157 12 Left 991032148 5:62094042-62094064 CCTTTGCTAAGTTTCCTAGCATG No data
Right 991032157 5:62094077-62094099 CCACACTCTCCTGTTGCCATGGG No data
991032149_991032157 -2 Left 991032149 5:62094056-62094078 CCTAGCATGTTCGTCCCCACCCC No data
Right 991032157 5:62094077-62094099 CCACACTCTCCTGTTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991032157 Original CRISPR CCACACTCTCCTGTTGCCAT GGG Intergenic
No off target data available for this crispr