ID: 991033542

View in Genome Browser
Species Human (GRCh38)
Location 5:62105893-62105915
Sequence AGTTATCTGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991033542_991033547 22 Left 991033542 5:62105893-62105915 CCTGCCATTTTCTGCAGATAACT No data
Right 991033547 5:62105938-62105960 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
991033542_991033546 16 Left 991033542 5:62105893-62105915 CCTGCCATTTTCTGCAGATAACT No data
Right 991033546 5:62105932-62105954 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
991033542_991033548 25 Left 991033542 5:62105893-62105915 CCTGCCATTTTCTGCAGATAACT No data
Right 991033548 5:62105941-62105963 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
991033542_991033545 15 Left 991033542 5:62105893-62105915 CCTGCCATTTTCTGCAGATAACT No data
Right 991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
991033542_991033544 4 Left 991033542 5:62105893-62105915 CCTGCCATTTTCTGCAGATAACT No data
Right 991033544 5:62105920-62105942 TTCTTTTGAGAGACAGCTCTTGG 0: 15
1: 201
2: 219
3: 189
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991033542 Original CRISPR AGTTATCTGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr