ID: 991035291

View in Genome Browser
Species Human (GRCh38)
Location 5:62122339-62122361
Sequence CCACCAGCTCCTGTCTCTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991035291_991035300 23 Left 991035291 5:62122339-62122361 CCGTAAGAGACAGGAGCTGGTGG No data
Right 991035300 5:62122385-62122407 TGTAAGTGGACAGTTCCAGGAGG No data
991035291_991035294 9 Left 991035291 5:62122339-62122361 CCGTAAGAGACAGGAGCTGGTGG No data
Right 991035294 5:62122371-62122393 TCAGCCACCCATCCTGTAAGTGG No data
991035291_991035298 20 Left 991035291 5:62122339-62122361 CCGTAAGAGACAGGAGCTGGTGG No data
Right 991035298 5:62122382-62122404 TCCTGTAAGTGGACAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991035291 Original CRISPR CCACCAGCTCCTGTCTCTTA CGG (reversed) Intergenic