ID: 991035609

View in Genome Browser
Species Human (GRCh38)
Location 5:62124562-62124584
Sequence CTGAGCAATGGTGATGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991035609_991035614 -3 Left 991035609 5:62124562-62124584 CCCGCAGCATCACCATTGCTCAG No data
Right 991035614 5:62124582-62124604 CAGGGCCCTGACTGATATTCCGG No data
991035609_991035618 12 Left 991035609 5:62124562-62124584 CCCGCAGCATCACCATTGCTCAG No data
Right 991035618 5:62124597-62124619 TATTCCGGATTGTACTCAAAGGG No data
991035609_991035617 11 Left 991035609 5:62124562-62124584 CCCGCAGCATCACCATTGCTCAG No data
Right 991035617 5:62124596-62124618 ATATTCCGGATTGTACTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991035609 Original CRISPR CTGAGCAATGGTGATGCTGC GGG (reversed) Intergenic
No off target data available for this crispr