ID: 991038646

View in Genome Browser
Species Human (GRCh38)
Location 5:62153675-62153697
Sequence ATGTTTACAAAGATAAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991038646_991038647 -8 Left 991038646 5:62153675-62153697 CCTGGATTTATCTTTGTAAACAT No data
Right 991038647 5:62153690-62153712 GTAAACATTTTTGTAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991038646 Original CRISPR ATGTTTACAAAGATAAATCC AGG (reversed) Intergenic
No off target data available for this crispr