ID: 991042283

View in Genome Browser
Species Human (GRCh38)
Location 5:62188323-62188345
Sequence CCCCTTCCTGCTCTGTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991042283_991042285 10 Left 991042283 5:62188323-62188345 CCTGAGCACAGAGCAGGAAGGGG No data
Right 991042285 5:62188356-62188378 ATCTGAAAGCAGAGAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991042283 Original CRISPR CCCCTTCCTGCTCTGTGCTC AGG (reversed) Intergenic
No off target data available for this crispr