ID: 991043004

View in Genome Browser
Species Human (GRCh38)
Location 5:62194787-62194809
Sequence GGCAGATGGCCTTCCTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991042999_991043004 1 Left 991042999 5:62194763-62194785 CCTCTGAGGCCTCTCTCCTTGGC 0: 37
1: 78
2: 113
3: 179
4: 477
Right 991043004 5:62194787-62194809 GGCAGATGGCCTTCCTCTTGTGG No data
991042996_991043004 17 Left 991042996 5:62194747-62194769 CCTGCAGCTTTAGTTTCCTCTGA No data
Right 991043004 5:62194787-62194809 GGCAGATGGCCTTCCTCTTGTGG No data
991043001_991043004 -8 Left 991043001 5:62194772-62194794 CCTCTCTCCTTGGCTGGCAGATG 0: 10
1: 215
2: 692
3: 1121
4: 1635
Right 991043004 5:62194787-62194809 GGCAGATGGCCTTCCTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991043004 Original CRISPR GGCAGATGGCCTTCCTCTTG TGG Intergenic
No off target data available for this crispr