ID: 991046124

View in Genome Browser
Species Human (GRCh38)
Location 5:62224568-62224590
Sequence GTTAGAGCCCTGATAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991046124_991046135 18 Left 991046124 5:62224568-62224590 CCTCCCATTATCAGGGCTCTAAC No data
Right 991046135 5:62224609-62224631 CTACCCTCTGGGAAGTCCAAGGG No data
991046124_991046138 25 Left 991046124 5:62224568-62224590 CCTCCCATTATCAGGGCTCTAAC No data
Right 991046138 5:62224616-62224638 CTGGGAAGTCCAAGGGAAAAAGG No data
991046124_991046131 7 Left 991046124 5:62224568-62224590 CCTCCCATTATCAGGGCTCTAAC No data
Right 991046131 5:62224598-62224620 TGCCCTCTGTTCTACCCTCTGGG No data
991046124_991046134 17 Left 991046124 5:62224568-62224590 CCTCCCATTATCAGGGCTCTAAC No data
Right 991046134 5:62224608-62224630 TCTACCCTCTGGGAAGTCCAAGG No data
991046124_991046130 6 Left 991046124 5:62224568-62224590 CCTCCCATTATCAGGGCTCTAAC No data
Right 991046130 5:62224597-62224619 CTGCCCTCTGTTCTACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991046124 Original CRISPR GTTAGAGCCCTGATAATGGG AGG (reversed) Intergenic
No off target data available for this crispr