ID: 991049414

View in Genome Browser
Species Human (GRCh38)
Location 5:62256440-62256462
Sequence CCTAACCAGCACCAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991049414_991049420 -2 Left 991049414 5:62256440-62256462 CCAACCAGCTGGTGCTGGTTAGG No data
Right 991049420 5:62256461-62256483 GGATTAGACCAGAGGGAGTTGGG No data
991049414_991049418 -9 Left 991049414 5:62256440-62256462 CCAACCAGCTGGTGCTGGTTAGG No data
Right 991049418 5:62256454-62256476 CTGGTTAGGATTAGACCAGAGGG No data
991049414_991049421 -1 Left 991049414 5:62256440-62256462 CCAACCAGCTGGTGCTGGTTAGG No data
Right 991049421 5:62256462-62256484 GATTAGACCAGAGGGAGTTGGGG No data
991049414_991049423 8 Left 991049414 5:62256440-62256462 CCAACCAGCTGGTGCTGGTTAGG No data
Right 991049423 5:62256471-62256493 AGAGGGAGTTGGGGTTGAAAAGG No data
991049414_991049419 -3 Left 991049414 5:62256440-62256462 CCAACCAGCTGGTGCTGGTTAGG No data
Right 991049419 5:62256460-62256482 AGGATTAGACCAGAGGGAGTTGG No data
991049414_991049417 -10 Left 991049414 5:62256440-62256462 CCAACCAGCTGGTGCTGGTTAGG No data
Right 991049417 5:62256453-62256475 GCTGGTTAGGATTAGACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991049414 Original CRISPR CCTAACCAGCACCAGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr