ID: 991054384

View in Genome Browser
Species Human (GRCh38)
Location 5:62306133-62306155
Sequence GCGCGCTCTGCGCAGGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991054379_991054384 3 Left 991054379 5:62306107-62306129 CCGAAAAGGAAGAAGAGACGCCG No data
Right 991054384 5:62306133-62306155 GCGCGCTCTGCGCAGGCGCGCGG No data
991054378_991054384 7 Left 991054378 5:62306103-62306125 CCAGCCGAAAAGGAAGAAGAGAC No data
Right 991054384 5:62306133-62306155 GCGCGCTCTGCGCAGGCGCGCGG No data
991054376_991054384 28 Left 991054376 5:62306082-62306104 CCTGGAGGCAGCGGGGAGAGGCC No data
Right 991054384 5:62306133-62306155 GCGCGCTCTGCGCAGGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991054384 Original CRISPR GCGCGCTCTGCGCAGGCGCG CGG Intergenic
No off target data available for this crispr