ID: 991066870

View in Genome Browser
Species Human (GRCh38)
Location 5:62433392-62433414
Sequence TATACGAACGTGCCTACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991066870_991066872 -9 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066872 5:62433406-62433428 GTTCGTATATTGGTTCTGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 75
991066870_991066876 16 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066876 5:62433431-62433453 GATATACTCTGGGCGCCAACTGG 0: 1
1: 0
2: 0
3: 2
4: 33
991066870_991066873 -8 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066873 5:62433407-62433429 TTCGTATATTGGTTCTGTGTGGG 0: 1
1: 0
2: 2
3: 17
4: 386
991066870_991066874 5 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066874 5:62433420-62433442 TCTGTGTGGGAGATATACTCTGG 0: 1
1: 0
2: 2
3: 8
4: 115
991066870_991066877 21 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066877 5:62433436-62433458 ACTCTGGGCGCCAACTGGTATGG No data
991066870_991066875 6 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066875 5:62433421-62433443 CTGTGTGGGAGATATACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991066870 Original CRISPR TATACGAACGTGCCTACAGT TGG (reversed) Intronic
918498737 1:185170177-185170199 TAAAAGAGCTTGCCTACAGTTGG - Intronic
920026636 1:203003271-203003293 TATACTAAACTGCCTTCAGTAGG + Intergenic
1108124424 13:47225626-47225648 TATACCAACATGCACACAGTGGG - Intergenic
1109922962 13:69093156-69093178 TATACCAAGGTGCCTAGAGATGG - Intergenic
1134475029 16:14566079-14566101 ACTACTAACCTGCCTACAGTGGG + Intronic
1162665509 19:12207437-12207459 TATAGGAACCTGGCTTCAGTAGG + Intergenic
935752517 2:106249103-106249125 TAAAAGAACTTGCCTACAGATGG + Intergenic
935912935 2:107916646-107916668 TAAAAGAACTTGCCTACAGATGG + Intergenic
988342383 5:29989801-29989823 TATACGAGCATGTCTACATTTGG - Intergenic
991066870 5:62433392-62433414 TATACGAACGTGCCTACAGTTGG - Intronic
999694320 5:154175309-154175331 TATATGAACATGCATTCAGTAGG + Intronic
1001784467 5:174400292-174400314 TACATGAACTTGCCTACACTAGG - Intergenic
1009918612 6:70028156-70028178 TATATTAACGTGCATACAGTGGG + Intronic
1020689412 7:11336482-11336504 TAAACAAATGTGCCTACAATTGG - Intergenic
1040972533 8:53152355-53152377 AGTAGGAATGTGCCTACAGTGGG + Intergenic
1041493219 8:58457962-58457984 AATACCAACTTGCTTACAGTAGG - Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1186243459 X:7594339-7594361 TATTAGAAAGTGCCTACAGAAGG + Intergenic
1197623541 X:128779028-128779050 GGTACCAACGTGCCCACAGTAGG - Intergenic
1198693995 X:139316185-139316207 TGTAGGAATGTGCATACAGTTGG - Intergenic