ID: 991066872

View in Genome Browser
Species Human (GRCh38)
Location 5:62433406-62433428
Sequence GTTCGTATATTGGTTCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991066870_991066872 -9 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066872 5:62433406-62433428 GTTCGTATATTGGTTCTGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991066872 Original CRISPR GTTCGTATATTGGTTCTGTG TGG Intronic
911160089 1:94675362-94675384 GTTGCTCTATTTGTTCTGTGGGG - Intergenic
920429869 1:205911613-205911635 GTTGGAATAATGGTTCTGGGTGG + Intergenic
921801280 1:219405373-219405395 ATTTGTATATTTGTTCTCTGAGG + Intergenic
1062834930 10:629299-629321 GCCCGGATCTTGGTTCTGTGTGG - Intronic
1064490970 10:15856811-15856833 ATTCTTATTTTGGTTCTGTTTGG + Intronic
1068191475 10:53657915-53657937 CTTCTTATGTTTGTTCTGTGGGG + Intergenic
1072568086 10:96634711-96634733 GTTGGTATATTAGTTTTCTGTGG + Intronic
1077511668 11:2968098-2968120 GTGCGGATTCTGGTTCTGTGGGG - Intronic
1081326507 11:41752316-41752338 ATTGTTATATTGGTCCTGTGAGG + Intergenic
1088753185 11:112863247-112863269 GCTCGTATATTGGTTCTCAAGGG + Intergenic
1091826587 12:3517410-3517432 GTTTGTCTATGGCTTCTGTGGGG - Intronic
1091939949 12:4470246-4470268 GTTCATATATTGGGTTTCTGTGG + Intergenic
1107625406 13:42276721-42276743 GTTAGTTAATAGGTTCTGTGTGG + Intronic
1108045538 13:46380685-46380707 ATTCTTATATTAGATCTGTGTGG - Intronic
1110182359 13:72633010-72633032 GTTTCTATATTGGTTCTCTTAGG - Intergenic
1113648841 13:112019221-112019243 CTTCTTAAATTGGTTCTGTCAGG + Intergenic
1116422575 14:44749870-44749892 GTTAGCATATTGGTTGTGTGGGG - Intergenic
1117908543 14:60614557-60614579 GTTCTTATAGTTGGTCTGTGTGG - Intergenic
1117925196 14:60771756-60771778 GTTAGTATATAGGCTCTATGAGG + Intronic
1118960670 14:70527601-70527623 GTTCTTATATTTGTTTTTTGAGG - Intronic
1120480422 14:85042403-85042425 GTTTGTAGTTTGGTTCTGTGTGG + Intergenic
1126963294 15:54022956-54022978 GTTTGTAAATTGGTTCAGAGGGG + Intronic
1129367277 15:75064055-75064077 GTTTGTCTATGGCTTCTGTGGGG - Intronic
1132083564 15:98887726-98887748 CGTCGTATAATGGATCTGTGAGG - Intronic
1143432164 17:6895214-6895236 GTCTGTATATTGGTTTTGGGAGG - Intronic
1144471555 17:15546861-15546883 GTTCGTATATTGCTTGTTTCTGG + Intronic
1154319617 18:13336747-13336769 GTTCTTATATTTGTGCTCTGTGG + Intronic
1158761272 18:60390434-60390456 GTTTGTATATTAGTTCTCTAGGG + Intergenic
925536550 2:4924465-4924487 ATTTGTATTTTGGTTGTGTGTGG + Intergenic
927175739 2:20406031-20406053 GGGCGTATACTGGGTCTGTGCGG - Intergenic
929684316 2:44021172-44021194 GTTGATATATTGGTTTTGTTAGG + Intergenic
929841069 2:45463803-45463825 ATGCATATATTGGTTGTGTGTGG - Intronic
936884634 2:117295321-117295343 GTTCTTATTCTGGTTATGTGTGG + Intergenic
1170912460 20:20587082-20587104 GTTCGTATGTTTGTTCTTTTTGG - Intronic
1170974411 20:21149140-21149162 GTTTGAATATTGGTTCTGCCTGG - Intronic
1172157483 20:32838445-32838467 GTTCATATACGGCTTCTGTGTGG + Intronic
1173417785 20:42872988-42873010 GTTATTATTGTGGTTCTGTGTGG - Intronic
1177830504 21:26133830-26133852 TTTCTTATATTGGTTCTGATTGG - Intronic
1179191454 21:39125879-39125901 GTTCATACATTTGTGCTGTGTGG - Intergenic
1183203794 22:36404539-36404561 GGCCGTATATTACTTCTGTGTGG + Intergenic
949866390 3:8550905-8550927 CCTCGCATATTTGTTCTGTGTGG + Intronic
950795101 3:15504232-15504254 GTTCGTGTATTGGTTTTCTAGGG + Intronic
951856524 3:27203153-27203175 GTTGGTATATGGGTTGTCTGGGG - Intronic
953184385 3:40624733-40624755 GTGCATGTTTTGGTTCTGTGTGG + Intergenic
955000954 3:54927613-54927635 GTTCGTATATTATTCCTTTGGGG - Intronic
964016262 3:151951254-151951276 GTTCTGTTATTGCTTCTGTGAGG - Intergenic
969697590 4:8743868-8743890 CTTCTTATAATGGCTCTGTGAGG + Intergenic
972397105 4:38666810-38666832 GCTCCAATTTTGGTTCTGTGGGG + Intronic
974554499 4:63426755-63426777 GTTCATTGATTTGTTCTGTGGGG + Intergenic
974760220 4:66265485-66265507 ATTTGCATATTGTTTCTGTGCGG + Intergenic
979145685 4:117244738-117244760 GTACGTATGTTTGTTCTGTTTGG - Intergenic
980072069 4:128253916-128253938 ATTGGTATATTGGTTCAGTCTGG + Intergenic
981892323 4:149752988-149753010 GATCTTATATTGGTTCCTTGGGG - Intergenic
983314839 4:166118116-166118138 CATTGTATATTGGTTTTGTGGGG + Intergenic
984463550 4:180067970-180067992 TATTGAATATTGGTTCTGTGGGG - Intergenic
991001502 5:61788099-61788121 GTTCCTAAATTCCTTCTGTGAGG - Intergenic
991066872 5:62433406-62433428 GTTCGTATATTGGTTCTGTGTGG + Intronic
998557733 5:143142025-143142047 CTTCTGATTTTGGTTCTGTGTGG - Intronic
1000653002 5:163840830-163840852 GTTTGTCTTTTGTTTCTGTGTGG - Intergenic
1007078603 6:39083440-39083462 GCTTGAATATTGGTTCTGTGTGG + Intronic
1007885147 6:45219557-45219579 GGTTGTATTTTGGTACTGTGTGG - Intronic
1009501943 6:64424968-64424990 GTTCCCACATTGGTTCCGTGTGG - Intronic
1009695100 6:67092598-67092620 GTTCGTATAATAGTTCCGCGTGG - Intergenic
1010753114 6:79636537-79636559 GTTTGTATATTAGTTCTCTAGGG + Intronic
1015357988 6:132302877-132302899 GTCCATATATTGGTTCTTTCTGG - Intronic
1020303162 7:6811541-6811563 GATCGTATTTTGTTTCTGTCAGG - Intronic
1021627926 7:22612897-22612919 GTTCAACTTTTGGTTCTGTGAGG + Intronic
1024918325 7:54528455-54528477 TTTTGTATACTGGTTTTGTGTGG + Intergenic
1037929054 8:22866576-22866598 TTTAGTATAGTGGTTATGTGTGG - Intronic
1043794623 8:84520916-84520938 GTTGCTATATTTATTCTGTGAGG - Intronic
1044671390 8:94684573-94684595 GTTGGTAAAATGGTTCTGTGTGG + Intronic
1045106310 8:98896195-98896217 GTTTGTAGATTGGATCTGAGAGG - Intronic
1056363920 9:85884275-85884297 GTTTATATAATGGTTCTGTTAGG - Intergenic
1186059624 X:5690176-5690198 GTTCTTTTTTTGGTTCTTTGAGG - Intergenic
1188910525 X:35841415-35841437 TTTCATATATGGGTTCTGTGGGG - Intergenic
1190010938 X:46784126-46784148 GTACGTGTATTGGGGCTGTGGGG - Intergenic
1192992393 X:76474246-76474268 GTTCGTTTAATGGTGATGTGAGG - Intergenic
1198453313 X:136790329-136790351 GATCATAGATTGGCTCTGTGGGG - Intergenic
1198486369 X:137091623-137091645 GTTGGTATATTGGCTCTGAAGGG - Intergenic
1199386987 X:147234403-147234425 GTTCATGTATTGATTCTGTTTGG - Intergenic
1200017914 X:153179977-153179999 GTTCATTTAATGGTTCTGAGGGG + Intronic