ID: 991066873

View in Genome Browser
Species Human (GRCh38)
Location 5:62433407-62433429
Sequence TTCGTATATTGGTTCTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 386}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991066870_991066873 -8 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066873 5:62433407-62433429 TTCGTATATTGGTTCTGTGTGGG 0: 1
1: 0
2: 2
3: 17
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991066873 Original CRISPR TTCGTATATTGGTTCTGTGT GGG Intronic
908554420 1:65243413-65243435 TTGATACATTGGTTCTGTCTAGG + Intergenic
909299830 1:73998249-73998271 TTTGTACATTGGGTGTGTGTAGG - Intergenic
910063040 1:83116994-83117016 TTTGTATATCGGTTCTGAGAAGG + Intergenic
910145248 1:84072359-84072381 TACACATATTGGTTCTGTATGGG - Intergenic
910810101 1:91227172-91227194 TTGGTAAATTGGTTCAGTCTAGG - Intergenic
911902228 1:103521297-103521319 TTGGTTTATTGGTTGTTTGTAGG + Intergenic
912583672 1:110742386-110742408 TTGATAAATTGGTTCTGTCTAGG - Intergenic
913289857 1:117262030-117262052 TTGATAAATTGGCTCTGTGTAGG - Intergenic
914198919 1:145467193-145467215 TTGATAAATTGGTTCTGTCTAGG - Intergenic
914478031 1:148040329-148040351 TTGATAAATTGGTTCTGTCTAGG - Intergenic
914502816 1:148262496-148262518 TTGATAAATTGGTTCTGTCTAGG + Intergenic
914511485 1:148336163-148336185 TTGATAAATTGGTTCTGTCTAGG - Intergenic
916238882 1:162619060-162619082 TTTTTATATTGGATCTGTTTAGG + Intergenic
916562517 1:165945365-165945387 TTTGTATATTGGTTCTGTGATGG - Intergenic
917936770 1:179875769-179875791 TTCCTATTTTGTTACTGTGTGGG - Intronic
918228074 1:182504806-182504828 TTTGTAGATTGGCTCTGTGTTGG + Intronic
924568379 1:245216759-245216781 TTCGCAAATTGGTTCTTTCTGGG + Intronic
924894259 1:248318295-248318317 TTAGTGTACTGGTTTTGTGTTGG - Intergenic
1063079049 10:2747466-2747488 TTCGTAATTATGTTCTGTGTTGG - Intergenic
1064170099 10:13023869-13023891 GTTGTATATTGGGTGTGTGTAGG - Intronic
1068291604 10:55008745-55008767 TTCATATATTGTCACTGTGTTGG + Intronic
1071010058 10:80927916-80927938 TTTGGAGATTGGCTCTGTGTTGG - Intergenic
1074842045 10:117364065-117364087 TTAGTATTTTGTTTGTGTGTGGG + Intronic
1074908712 10:117887818-117887840 TTTCTATATTGATTCTGTCTTGG + Intergenic
1076651101 10:131988722-131988744 TTGATAAATTGGTTCTGTCTAGG - Intergenic
1078787997 11:14515390-14515412 TTTTTATATTGATTATGTGTTGG + Intronic
1081838648 11:46178613-46178635 TTCTTATAATGACTCTGTGTGGG - Intergenic
1082467717 11:53198741-53198763 TTCTGATAATGCTTCTGTGTAGG - Intergenic
1084990912 11:72924591-72924613 TTCTTTTGTTGCTTCTGTGTTGG + Intronic
1087846376 11:102978100-102978122 TTTGTCTATTGTTTGTGTGTAGG + Intergenic
1088387443 11:109275390-109275412 TTAGTATACTGGTTTTATGTTGG + Intergenic
1089591369 11:119543191-119543213 TTCGCATTATGGTTCAGTGTTGG + Intergenic
1090157977 11:124461524-124461546 TTCCTATATTGATACTGTATTGG - Intergenic
1090310654 11:125734188-125734210 TTTGCAGATTGGCTCTGTGTTGG - Intergenic
1090328291 11:125907739-125907761 TTCTTATATTAGTTCTTTCTAGG - Intronic
1092562789 12:9633884-9633906 TTGATATATTGGCTCTGTCTAGG + Intergenic
1092811752 12:12277116-12277138 TTTGCAAATTGGCTCTGTGTTGG - Intergenic
1093193471 12:16102506-16102528 TTTGTATATGGATTTTGTGTAGG + Intergenic
1094121243 12:26976982-26977004 CTCATATATTTGTTCTGGGTCGG - Intronic
1097472776 12:60016490-60016512 TTTGTAGATTGCTTCTGTGTTGG - Intergenic
1098729277 12:74012165-74012187 TTCATAAATTGGCTCTGTCTAGG + Intergenic
1098794413 12:74870115-74870137 TTCGTATATTGGATCTTTCTAGG + Intergenic
1099320564 12:81143085-81143107 TTCTTATATTTTTGCTGTGTAGG + Exonic
1100223422 12:92531665-92531687 TTCAAATATAGGTTCTTTGTTGG - Intergenic
1100951731 12:99858137-99858159 TTTGGATATTGGTCCTTTGTTGG - Intronic
1102325820 12:111982835-111982857 TTTGCAGATTGGTTCTGTATTGG - Intronic
1104058938 12:125251719-125251741 CTAGTTTATTGGTTCTGTTTGGG + Intronic
1106040288 13:26083870-26083892 TTAATATAATGGTTTTGTGTTGG + Intergenic
1106072804 13:26429456-26429478 TTGGTATATTGGATGTGTCTAGG - Intergenic
1106542361 13:30701285-30701307 TTGATAAATTGGTTCTGTCTAGG + Intergenic
1107625407 13:42276722-42276744 TTAGTTAATAGGTTCTGTGTGGG + Intronic
1107746722 13:43518117-43518139 TTCTTAGATTGGTTTTGTTTTGG - Intronic
1108134263 13:47338471-47338493 TTAGTGTATTGGTTTTGTGTTGG - Intergenic
1108134423 13:47339794-47339816 TTGATAAATTGGTTCTGTCTAGG + Intergenic
1109484938 13:63006623-63006645 TCTGAATATTGGTTCTTTGTTGG - Intergenic
1111792677 13:92878612-92878634 TTTTTATATTGCTTATGTGTTGG - Intergenic
1112150918 13:96762596-96762618 CTCGTGGGTTGGTTCTGTGTAGG + Intronic
1113356187 13:109582634-109582656 TTCTTATATGCCTTCTGTGTAGG - Intergenic
1113500023 13:110765944-110765966 TTTGTTTATTGTTTCTGTCTGGG + Intergenic
1114657303 14:24323833-24323855 TTCTTATCTTTTTTCTGTGTAGG - Intronic
1115186446 14:30693697-30693719 TTTGTATATTGGTTCTACGTTGG + Intronic
1115534169 14:34357295-34357317 TTGATAAATTGGTTCTGTCTAGG - Intronic
1120423626 14:84319558-84319580 TTCGTATATTGCTTATGTCCAGG - Intergenic
1123055955 14:105570725-105570747 GTGGTGTATGGGTTCTGTGTGGG - Intergenic
1123386878 15:19820500-19820522 TTCTCAGATTGCTTCTGTGTAGG + Intergenic
1130398891 15:83530524-83530546 TTCCTATTTTGGTTCTTTTTTGG + Intronic
1132913349 16:2327451-2327473 TTCTTTTATGGGTTCAGTGTTGG - Intronic
1133760417 16:8794254-8794276 TGGGTATATTAGTTCTGTTTGGG + Intronic
1135998357 16:27270330-27270352 TTGATAAATTGGTTCTGTCTAGG - Intronic
1138825049 16:60308909-60308931 TTGATAAATTGGTTCTGTCTAGG - Intergenic
1140589453 16:76334340-76334362 TTTGCAGATTGGGTCTGTGTTGG + Intronic
1142690333 17:1602311-1602333 TTTGTATATTGATTTTGTGAAGG + Intronic
1151146190 17:72043657-72043679 TTCTTATATTGTTATTGTGTAGG - Intergenic
1155932188 18:31719548-31719570 TTGGTAAATTGGCTCTGTCTAGG - Intergenic
1165190673 19:34060413-34060435 TACCTATTTTGGTACTGTGTTGG - Intergenic
1168555594 19:57336760-57336782 TTCTTTTTTTGTTTCTGTGTTGG + Intergenic
929737935 2:44570592-44570614 GTCCTATATTGTTTCTGTTTTGG - Intronic
931079599 2:58753985-58754007 TTCTTATATTGCTTCTGGGCAGG + Intergenic
932897844 2:75660704-75660726 TTTGTAGATTGGTTCTGTGCTGG + Intronic
934471604 2:94547059-94547081 TTCTCACATTGCTTCTGTGTAGG + Intergenic
934472694 2:94568888-94568910 TTCTCAGATTGCTTCTGTGTAGG + Intergenic
937184958 2:120031299-120031321 TTGATAAATTGGTTCTGTCTAGG + Intronic
937461099 2:122086829-122086851 TTTGGATATTAGTTCTTTGTTGG + Intergenic
939983438 2:148807587-148807609 TTTGCAGATTGGCTCTGTGTTGG + Intergenic
940063748 2:149602531-149602553 TTGGTATATTGCTTTAGTGTGGG + Intergenic
940815135 2:158289325-158289347 TTTGCATATTAGTTCTTTGTGGG - Intronic
942583408 2:177446522-177446544 TTTGTATATTGGGTGGGTGTGGG + Intronic
945068845 2:205971082-205971104 TACGTAAATTAGTTTTGTGTTGG + Intergenic
1173417784 20:42872987-42873009 TTATTATTGTGGTTCTGTGTGGG - Intronic
1179191453 21:39125878-39125900 TTCATACATTTGTGCTGTGTGGG - Intergenic
1180397162 22:12362569-12362591 TTCGCAGATTGCTTCTGTCTAGG + Intergenic
1180402556 22:12501567-12501589 TTCGCAGATTGCTTCTGTCTAGG - Intergenic
1180509421 22:16064367-16064389 TTCTCAGATTGCTTCTGTGTAGG + Intergenic
949524343 3:4888553-4888575 TTCGTGTATTGGTTGGGTGATGG - Intergenic
949685775 3:6568253-6568275 TTTGTTTATTGGTTGTGTGTAGG - Intergenic
953917526 3:46930239-46930261 TTCGTTGGTTGTTTCTGTGTAGG - Intronic
956396958 3:68836173-68836195 ATTGAATATTGGTTCTGTTTTGG + Intronic
960021260 3:112956631-112956653 TTCATAGATTGACTCTGTGTGGG + Intronic
960355520 3:116648244-116648266 TTCATCTTTTTGTTCTGTGTGGG - Intronic
963695650 3:148563637-148563659 TTCTGATATTTGTCCTGTGTAGG + Intergenic
963712557 3:148763719-148763741 TGAGTATATTATTTCTGTGTAGG - Intergenic
963855307 3:150247349-150247371 TTCATGTATTGTTTCTTTGTAGG - Intergenic
964299404 3:155271308-155271330 TTAGTATGCTGGTTTTGTGTTGG - Intergenic
964366190 3:155953203-155953225 TTGATAAATTGGCTCTGTGTAGG - Intergenic
965038726 3:163478622-163478644 TTGGTTTATTGGTTAGGTGTGGG - Intergenic
966821334 3:183927154-183927176 TGGGTATATTGGTTCTGGGGAGG - Intronic
967572823 3:191050906-191050928 TTCCTATACTGGTGTTGTGTGGG - Intergenic
968528765 4:1078839-1078861 GTCCTATGTTGGTCCTGTGTTGG - Intronic
968528787 4:1078949-1078971 GTCCTATGTTGGTCCTGTGTTGG - Intronic
970068824 4:12130582-12130604 TTTGGAGCTTGGTTCTGTGTGGG - Intergenic
970650020 4:18167352-18167374 TTCATAAATTGGTTCTGTCTAGG + Intergenic
972675870 4:41258319-41258341 TTTGTGTATGGTTTCTGTGTGGG + Intronic
973306320 4:48655289-48655311 GTGGTATTATGGTTCTGTGTTGG - Intronic
974760221 4:66265486-66265508 TTTGCATATTGTTTCTGTGCGGG + Intergenic
975707220 4:77123053-77123075 TTGATAAATTGGTTCTGTCTAGG + Intergenic
976835787 4:89371651-89371673 TTCACATATTGTTTCTGTGTTGG - Intergenic
979928987 4:126605723-126605745 TCCGTGTATTCGTTCTGAGTCGG - Intergenic
980048803 4:128018319-128018341 TTAGTATTTTGTTTGTGTGTGGG + Intronic
980536260 4:134127342-134127364 TTAGTACACTGGTTTTGTGTTGG - Intergenic
984463549 4:180067969-180067991 ATTGAATATTGGTTCTGTGGGGG - Intergenic
986634038 5:9802117-9802139 TTAGTGTGTTGGTTTTGTGTTGG - Intergenic
986850044 5:11801253-11801275 TTATTACATTTGTTCTGTGTTGG - Intronic
986932766 5:12847354-12847376 TTTGTTTATTAGTTCTGTTTTGG - Intergenic
988894655 5:35658934-35658956 TTTGTATATTGTTTCTGTATAGG + Intronic
990605517 5:57405953-57405975 TACAAATATGGGTTCTGTGTTGG + Intergenic
991066873 5:62433407-62433429 TTCGTATATTGGTTCTGTGTGGG + Intronic
992034551 5:72759637-72759659 TTCTTAAATAGCTTCTGTGTAGG + Intergenic
992203149 5:74403727-74403749 TTTGGAGATTGGTTCAGTGTAGG - Intergenic
992771209 5:80050184-80050206 TTGATAAATGGGTTCTGTGTAGG - Intronic
993165346 5:84346851-84346873 TCCATCTCTTGGTTCTGTGTTGG - Intronic
994063732 5:95510827-95510849 TTGATATATTGGCTCTGTCTAGG + Intronic
994706548 5:103213884-103213906 TTCTTTCAGTGGTTCTGTGTAGG - Intergenic
996919085 5:128746479-128746501 TTGATAAATTGGTTCTGTCTAGG - Intronic
997576242 5:134979876-134979898 TTTTTAGATTGGCTCTGTGTTGG - Intronic
998261750 5:140637017-140637039 TTGGTACAATGGTTCTGAGTAGG + Intergenic
998927859 5:147146695-147146717 TTCGTATATTAGACCTTTGTTGG - Intergenic
998996779 5:147874759-147874781 TTCATACATTGGCTCTGTCTAGG + Intronic
1000131223 5:158301764-158301786 ATCATATATGTGTTCTGTGTTGG - Intergenic
1003804459 6:9711238-9711260 GTCATATTTTGTTTCTGTGTGGG - Intronic
1004468427 6:15906885-15906907 TTGATAAATTGGTTCTGTCTAGG - Intergenic
1006346689 6:33488129-33488151 TTTGCAGATTGGCTCTGTGTTGG + Intergenic
1007276876 6:40680525-40680547 TTGATAAATTGGTTCTGTCTGGG + Intergenic
1007919816 6:45596585-45596607 ATCCTATAATGTTTCTGTGTGGG + Intronic
1009065231 6:58452518-58452540 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009065512 6:58556429-58556451 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009065726 6:58559486-58559508 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009065946 6:58562543-58562565 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009066064 6:58564238-58564260 TTCGGAGATTGCTTCTGTCTAGG - Intergenic
1009066384 6:58568662-58568684 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009067479 6:58583953-58583975 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009068143 6:58593126-58593148 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009068369 6:58596184-58596206 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009069026 6:58605336-58605358 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009069461 6:58611450-58611472 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009070337 6:58623671-58623693 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009070550 6:58626729-58626751 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009070984 6:58632825-58632847 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009071422 6:58638940-58638962 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009071861 6:58645054-58645076 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009072078 6:58648112-58648134 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009072513 6:58654226-58654248 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009072731 6:58657283-58657305 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009073169 6:58663398-58663420 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009073611 6:58669515-58669537 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009074051 6:58675624-58675646 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009074493 6:58681738-58681760 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009075148 6:58690909-58690931 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009076022 6:58703136-58703158 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009076091 6:58703982-58704004 TTCTGATATTGCTTCTGTCTTGG - Intergenic
1009076238 6:58706193-58706215 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009076454 6:58709251-58709273 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009076897 6:58715366-58715388 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009077339 6:58721482-58721504 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009077774 6:58727595-58727617 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009077994 6:58730652-58730674 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009078436 6:58736768-58736790 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009078874 6:58742863-58742885 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009079316 6:58748979-58749001 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009079937 6:58757646-58757668 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009080153 6:58760703-58760725 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009080598 6:58766819-58766841 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009081034 6:58772913-58772935 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009081473 6:58779027-58779049 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009081691 6:58782084-58782106 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009081908 6:58785142-58785164 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009083006 6:58800433-58800455 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009083225 6:58803491-58803513 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009083660 6:58809585-58809607 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009084324 6:58818756-58818778 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009084543 6:58821814-58821836 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009084765 6:58824871-58824893 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009085861 6:58840140-58840162 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009086077 6:58843197-58843219 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009086737 6:58852370-58852392 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009088273 6:58873754-58873776 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009088493 6:58876811-58876833 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009089584 6:58892059-58892081 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009090023 6:58898174-58898196 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009090245 6:58901233-58901255 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009090464 6:58904291-58904313 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009090686 6:58907348-58907370 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009090905 6:58910406-58910428 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009091123 6:58913462-58913484 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009091340 6:58916519-58916541 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009091776 6:58922632-58922654 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009093096 6:58940957-58940979 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009093531 6:58947071-58947093 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009093964 6:58953186-58953208 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009094183 6:58956243-58956265 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009094400 6:58959300-58959322 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009094618 6:58962358-58962380 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009094910 6:58966261-58966283 TTCTGATATTGCTTCTGTCTTGG - Intergenic
1009095061 6:58968473-58968495 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009095278 6:58971531-58971553 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009095934 6:58980702-58980724 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009096592 6:58989875-58989897 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009097923 6:59008214-59008236 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009098363 6:59014327-59014349 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009098795 6:59020421-59020443 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009099238 6:59026532-59026554 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009099682 6:59032643-59032665 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009100341 6:59041813-59041835 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009101441 6:59057101-59057123 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009101660 6:59060159-59060181 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009102102 6:59066275-59066297 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009104084 6:59093770-59093792 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009104305 6:59096827-59096849 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009104969 6:59105998-59106020 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009105189 6:59109054-59109076 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009105583 6:59114659-59114681 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009105802 6:59117716-59117738 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009106020 6:59120775-59120797 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009107119 6:59136054-59136076 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009107337 6:59139112-59139134 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009108003 6:59148265-59148287 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009108659 6:59157441-59157463 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009109317 6:59166613-59166635 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009110410 6:59181896-59181918 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009110629 6:59184950-59184972 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009111066 6:59191044-59191066 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009111721 6:59200219-59200241 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009113039 6:59218540-59218562 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009113912 6:59230767-59230789 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009114132 6:59233825-59233847 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009114792 6:59242998-59243020 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009115665 6:59255231-59255253 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009116111 6:59261347-59261369 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009116555 6:59267462-59267484 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009117383 6:59278843-59278865 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009117601 6:59281901-59281923 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009117816 6:59284958-59284980 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009118036 6:59288016-59288038 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009118253 6:59291072-59291094 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009118520 6:59294766-59294788 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009118741 6:59297817-59297839 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009119402 6:59306967-59306989 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009119619 6:59310025-59310047 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009120455 6:59321743-59321765 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009120893 6:59327858-59327880 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009121315 6:59333803-59333825 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009121762 6:59339917-59339939 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009121983 6:59342975-59342997 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009122426 6:59349091-59349113 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009123523 6:59364344-59364366 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009123747 6:59367403-59367425 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009124627 6:59379630-59379652 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009125066 6:59385745-59385767 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009125721 6:59394900-59394922 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009125943 6:59397958-59397980 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009126164 6:59401015-59401037 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009126596 6:59407132-59407154 TTCTGAGATGGGTTCTGTGTAGG - Intergenic
1009126818 6:59410192-59410214 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009127039 6:59413249-59413271 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009127707 6:59422424-59422446 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009128360 6:59431600-59431622 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009129033 6:59440960-59440982 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009129252 6:59444017-59444039 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009129470 6:59447073-59447095 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009130138 6:59456246-59456268 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009130577 6:59462361-59462383 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009130796 6:59465418-59465440 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009131015 6:59468478-59468500 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009131233 6:59471535-59471557 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009132783 6:59493110-59493132 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009132997 6:59496168-59496190 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009134319 6:59514513-59514535 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009134389 6:59515359-59515381 TTCTGATATTGCTTCTGTCTTGG - Intergenic
1009135032 6:59524378-59524400 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009135690 6:59533555-59533577 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009136130 6:59539669-59539691 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009136566 6:59545789-59545811 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009136782 6:59548846-59548868 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009137002 6:59551901-59551923 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009137221 6:59554959-59554981 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009137440 6:59558016-59558038 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009137656 6:59561073-59561095 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009137884 6:59564131-59564153 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009138106 6:59567189-59567211 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009138327 6:59570230-59570252 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009138916 6:59578558-59578580 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009139142 6:59581615-59581637 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009139808 6:59590790-59590812 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009140250 6:59596907-59596929 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009141129 6:59609138-59609160 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009141565 6:59615251-59615273 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009142006 6:59621344-59621366 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009142667 6:59630498-59630520 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009143105 6:59636593-59636615 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009143330 6:59639650-59639672 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009143776 6:59645764-59645786 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009143999 6:59648823-59648845 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009144218 6:59651880-59651902 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009145098 6:59664090-59664112 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009145754 6:59673261-59673283 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009145976 6:59676314-59676336 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009146420 6:59682431-59682453 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009146639 6:59685488-59685510 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009146858 6:59688545-59688567 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009147074 6:59691602-59691624 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009147513 6:59697717-59697739 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009147958 6:59703831-59703853 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009148620 6:59713000-59713022 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009148839 6:59716058-59716080 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009149054 6:59719108-59719130 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009149490 6:59725228-59725250 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009149706 6:59728285-59728307 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009149924 6:59731342-59731364 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009150144 6:59734394-59734416 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009151683 6:59755799-59755821 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009152122 6:59761914-59761936 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009152340 6:59764970-59764992 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009153662 6:59783313-59783335 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009155435 6:59807759-59807781 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009155653 6:59810816-59810838 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009156324 6:59820248-59820270 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009156540 6:59823305-59823327 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009156979 6:59829419-59829441 TTCTGAGATTGGTTCTGTCTAGG - Intergenic
1009389658 6:63130616-63130638 TTAGTATGCTGGTTTTGTGTTGG + Intergenic
1010401212 6:75448604-75448626 TCTGCATATTGGTTCTTTGTTGG - Intronic
1010817484 6:80375912-80375934 TACGTGTGTTGGTTTTGTGTTGG + Intergenic
1011676178 6:89736453-89736475 TTTGTCTTTTGGGTCTGTGTCGG - Intronic
1017427291 6:154335477-154335499 TTCTTATATTGATACTGTATGGG - Intronic
1017612968 6:156211162-156211184 TTTTTATATTGATTCTGTATTGG + Intergenic
1017980581 6:159397874-159397896 TTGATAAATTGGTTCTGTCTAGG + Intergenic
1020774237 7:12432978-12433000 TTTATAGATTGGCTCTGTGTTGG + Intergenic
1021226537 7:18034498-18034520 TCTGGATATTGGTTCTTTGTCGG + Intergenic
1021732406 7:23608737-23608759 TTGATAAATTGGTTCTGTCTAGG - Intronic
1024780647 7:52844070-52844092 TGCGTATGTGGGTTCTATGTGGG + Intergenic
1024918326 7:54528456-54528478 TTTGTATACTGGTTTTGTGTGGG + Intergenic
1025277926 7:57600591-57600613 TTCCTATGTTGTTTCTGTGTAGG + Intergenic
1025922848 7:65930110-65930132 TTTGTATATTGGTCTTGTGCCGG + Intronic
1027193970 7:76015619-76015641 TTTGGATATTGGATCTTTGTTGG - Intronic
1027660035 7:80977915-80977937 TTTGCAGATTGGTTCTGTGTTGG + Intergenic
1027673527 7:81131318-81131340 TTTATATTTTTGTTCTGTGTGGG + Intergenic
1028197793 7:87927151-87927173 TTAGTGTACTGGTTTTGTGTTGG - Intergenic
1029004077 7:97189023-97189045 TTCAAATATTGGTTCTGCCTCGG - Intergenic
1029178185 7:98680190-98680212 TTCTTATATTGATTATATGTCGG - Intergenic
1032247622 7:130226269-130226291 TTGATAAATTGGTTCTGTCTAGG + Intergenic
1034832318 7:154320154-154320176 TTTTTATATTGCTTCTATGTTGG - Intronic
1037929053 8:22866575-22866597 TTAGTATAGTGGTTATGTGTGGG - Intronic
1037954570 8:23044284-23044306 TTCCTATATTGCTTGTGTTTTGG - Intronic
1039661162 8:39468429-39468451 TTCGGATATTAGTCCTTTGTTGG + Intergenic
1041115208 8:54529035-54529057 TCAGGATATTGGTTCTTTGTAGG + Intergenic
1042431441 8:68710856-68710878 TTAGTGTGCTGGTTCTGTGTTGG - Intronic
1043511630 8:80955924-80955946 TTTGTATATAGTTTTTGTGTGGG - Intergenic
1043876380 8:85491408-85491430 TTAGTGTACTGGTTTTGTGTTGG + Intergenic
1043996527 8:86824547-86824569 TTCATATATTGGGCCTGTTTTGG + Intergenic
1044279609 8:90340179-90340201 TTTCTATATTAGTTCTCTGTAGG - Intergenic
1049811714 8:144577961-144577983 TTGGAATTTTGGATCTGTGTGGG - Intronic
1050213643 9:3294841-3294863 TTCGTATATGTGTCCTGTGAAGG - Intronic
1050375180 9:4964381-4964403 TTTGTAGATTGGTTCTGTGTTGG + Intergenic
1050380616 9:5024401-5024423 TTTGCAGATTGGCTCTGTGTTGG + Intronic
1051266871 9:15317799-15317821 TTGATAAATTGGTTCTGTCTAGG - Intergenic
1053687008 9:40540885-40540907 TTCTCAGATTGCTTCTGTGTAGG - Intergenic
1053687185 9:40544673-40544695 TTCTCAGATTGCTTCTGTGTAGG - Intergenic
1053937147 9:43171300-43171322 TTCTCAGATTGCTTCTGTGTAGG - Intergenic
1054276742 9:63085313-63085335 TTCTCAGATTGCTTCTGTGTAGG + Intergenic
1054398095 9:64679617-64679639 TTCTCAGATTGCTTCTGTGTAGG - Intergenic
1059258558 9:112953920-112953942 TTGGCATATTGGTATTGTGTTGG + Intergenic
1059610683 9:115889571-115889593 TTGGAATATTGGATTTGTGTGGG + Intergenic
1060314416 9:122496138-122496160 TTAGTGTGTTGGTTTTGTGTTGG + Intergenic
1060568173 9:124612842-124612864 TTTGTATAATGGTTGTGTGATGG - Intronic
1061156561 9:128865656-128865678 TTCAAATATTGGCTCTGTGCTGG - Intronic
1186308428 X:8290190-8290212 TTAGTGTGTTGGTTTTGTGTTGG - Intergenic
1188111445 X:26199201-26199223 TTCTCATATTGGCTCTGTGTAGG - Intergenic
1188317159 X:28689057-28689079 TTGGTATCTTGGTTCTATATAGG - Intronic
1188626630 X:32293154-32293176 TTCTCAGATTGTTTCTGTGTTGG - Intronic
1188900336 X:35724617-35724639 TTTGCAAATTGGGTCTGTGTTGG + Intergenic
1188910524 X:35841414-35841436 TTCATATATGGGTTCTGTGGGGG - Intergenic
1190380301 X:49834071-49834093 TTTGTATACTGATTTTGTGTTGG + Intergenic
1191805087 X:65127452-65127474 TTAGTGCATTGGTTTTGTGTTGG + Intergenic
1193433970 X:81448896-81448918 TTGATAAATTGGTTCTGTCTAGG + Intergenic
1193748181 X:85309551-85309573 TTCATATATTAGATCAGTGTTGG + Intronic
1193929849 X:87540539-87540561 TGATTATATTGATTCTGTGTAGG - Intronic
1193937161 X:87637036-87637058 TTAGTATGCTGGTTTTGTGTTGG - Intronic
1194875680 X:99185011-99185033 TTTGACTATTGTTTCTGTGTGGG + Intergenic
1195067769 X:101253093-101253115 TTCCTATATTGCTTCTGTACTGG + Intronic
1195214446 X:102684877-102684899 TTTGTAGATTGGCTCTGTGTTGG + Intergenic
1196287572 X:113900023-113900045 TTGATAAATTGGTTCTGTCTAGG + Intergenic
1196970997 X:121108518-121108540 TTGGTTTACTGTTTCTGTGTTGG + Intergenic
1196997445 X:121399909-121399931 TTGATAAATTGGTTCTGTCTAGG - Intergenic
1197254584 X:124249479-124249501 ATTGCAGATTGGTTCTGTGTTGG + Intronic
1198897089 X:141467467-141467489 AGCGTATATTGGTTATATGTGGG + Intergenic
1199321650 X:146446559-146446581 TTGATAAATTGGTTCTGTCTAGG + Intergenic
1201853025 Y:18509086-18509108 TTGGTATTTTGGTTCTTTGGAGG + Intergenic
1201880296 Y:18811298-18811320 TTGGTATTTTGGTTCTTTGGAGG - Intronic