ID: 991066874

View in Genome Browser
Species Human (GRCh38)
Location 5:62433420-62433442
Sequence TCTGTGTGGGAGATATACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991066870_991066874 5 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066874 5:62433420-62433442 TCTGTGTGGGAGATATACTCTGG 0: 1
1: 0
2: 2
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991066874 Original CRISPR TCTGTGTGGGAGATATACTC TGG Intronic
907524766 1:55047721-55047743 TTTGTGTGGGGGACATCCTCTGG + Intronic
907806028 1:57821190-57821212 TCTGTGTGAGAGGTTTTCTCTGG - Intronic
908616267 1:65926139-65926161 TCTGTGTGGTAAATATCCTCAGG + Intronic
913955209 1:143284248-143284270 TCTGAGTAAGAGATATGCTCAGG - Intergenic
913982228 1:143531196-143531218 TCTGAGTAAGAGATATGCTCAGG + Intergenic
919646304 1:200098218-200098240 TCTGTTTGGGAGATGAACTGAGG - Intronic
919789381 1:201280706-201280728 ACGGTGAGGGAGATATACTCAGG - Intergenic
920231756 1:204475337-204475359 CCTGTGTTTGAGATATACACTGG - Intronic
922464978 1:225840296-225840318 TCAGTGTAGGATATAGACTCAGG - Intronic
1063981708 10:11457792-11457814 TCAGTGTTGGAGATATGCCCAGG - Intronic
1064737261 10:18395074-18395096 TCTGCATGTGATATATACTCAGG - Intronic
1066164955 10:32777092-32777114 TATATGTGGGAGATAAACACTGG - Intronic
1080956768 11:37106659-37106681 TCAGTGGGGGAGATAGATTCAGG + Intergenic
1082898203 11:58215458-58215480 CCTGTGTGGAAGATACTCTCAGG - Exonic
1083364347 11:62132530-62132552 TCTGTTTTGGAGATTTTCTCAGG + Intronic
1086781019 11:90905980-90906002 TCTGTAAGGAAGATATACCCCGG - Intergenic
1088969048 11:114755253-114755275 GCTGTGTGGGGGATGTACTAAGG + Intergenic
1099976108 12:89546899-89546921 TCTGTGAGGTAGATGTCCTCTGG + Intergenic
1112174335 13:97006974-97006996 GCTCTGAGGGAGAGATACTCAGG - Intergenic
1114016581 14:18435401-18435423 TATGTGAGGGACAAATACTCAGG + Intergenic
1114019559 14:18465317-18465339 TATGTGAGGGAGAAATACCCAGG + Intergenic
1114389811 14:22294955-22294977 CCTGTGTGGCAGATACTCTCTGG - Intergenic
1114899645 14:27041259-27041281 TCTGCTTGGGAGAAATACTATGG + Intergenic
1115207115 14:30920338-30920360 TCTGTGGGGGGGAAATCCTCAGG - Intronic
1117908884 14:60617467-60617489 TCTATGTGGGAGAGATTCTTAGG - Intergenic
1121207690 14:92183013-92183035 CCTGTGTGGGTGACATTCTCAGG - Intergenic
1121611716 14:95285439-95285461 TGTGTGTGGGAGAGAGAATCTGG + Intronic
1122428506 14:101625370-101625392 TCTGTGTGGCAGTTATTCTCAGG - Intergenic
1124365347 15:29067258-29067280 TCTTTGTGGGTGATATAGTTTGG - Intronic
1124724802 15:32147177-32147199 TCTGAGTGGGAGCTAAACACTGG + Intronic
1129388612 15:75209259-75209281 TCAGTGTGGGAGAGAGACCCAGG - Intronic
1129509105 15:76107360-76107382 CCTGTGTGAGCGACATACTCTGG - Intronic
1131363911 15:91821215-91821237 TCTGTGTGGAACACTTACTCTGG + Intergenic
1131483627 15:92802549-92802571 TCTCTGTGGCAGAAATTCTCTGG + Intronic
1139151095 16:64382290-64382312 TCTGAGTATGAGAAATACTCAGG + Intergenic
1142868343 17:2804807-2804829 TGTGTGTGGGATATAGCCTCAGG + Intronic
1143563221 17:7707327-7707349 TCTGAGTGGGAGAATGACTCAGG + Intronic
1150749878 17:67850858-67850880 TCTGTGTGGGAAACATGCTAGGG + Intronic
1155969087 18:32064323-32064345 TGTGTGTGTGAGATATAGTTTGG - Intronic
1156382071 18:36572342-36572364 TCTGTGTGGGTTTTATTCTCAGG + Intronic
1157344737 18:46816213-46816235 TCTGTGTGGTGGTTATATTCGGG - Intronic
1157636207 18:49157341-49157363 TATGTGTGGGAGAGACAGTCTGG - Intronic
1157846361 18:51007277-51007299 TCTATGGGGGAGAGAGACTCTGG - Intronic
1158206958 18:55004007-55004029 CCTGTGTGGGTGATAAAGTCTGG - Intergenic
1161647885 19:5465588-5465610 TGTATGTGGGAGATAAACCCAGG + Intergenic
1161997764 19:7724460-7724482 TGTGTGTGTGAGATATAGTTAGG - Intergenic
1162658470 19:12150776-12150798 TGTGAGTGGGAGATACTCTCAGG - Intronic
1164028750 19:21380846-21380868 TCTGTTTGGGAGAAATGCTGAGG + Intergenic
1164059136 19:21651231-21651253 TCTGTGTGGGAGAAATACTTTGG + Intergenic
1164067516 19:21732271-21732293 TCTATGTGGGAGAAACACTTTGG - Intronic
932305583 2:70700214-70700236 TCTGTGTTGGAGATATATTCAGG - Intronic
932942218 2:76180937-76180959 GCTTTGTGGGAAATATACCCAGG + Intergenic
933353854 2:81190877-81190899 TCTATGTGGGAAATAAACTGGGG + Intergenic
936301161 2:111305910-111305932 CCTGTGGGGGAGAAATACCCTGG + Intergenic
941486987 2:166094354-166094376 TCTGTCTGGCAGATATTCTCTGG - Intronic
946085642 2:217168536-217168558 TCTCTGTGGGAGAGACACACTGG + Intergenic
947739798 2:232479938-232479960 GCTGTGAGGGAAATATACTGGGG - Exonic
1171193150 20:23175467-23175489 ATTGTCTGGGGGATATACTCTGG + Intergenic
1174570742 20:51499341-51499363 TCTGTGTGGGAGCTGGGCTCGGG - Intronic
1180224848 21:46386256-46386278 TCTGTGTGGGAGATAACGGCTGG - Intronic
1180441087 22:15366274-15366296 TATGTGAGGGACAAATACTCAGG + Intergenic
1180444063 22:15396142-15396164 TATGTGAGGGAGAAATACCCAGG + Intergenic
949491496 3:4593999-4594021 TCTATGTGGGAGATATGATATGG + Intronic
951738879 3:25898265-25898287 GCGGTGTGGGAGCTACACTCAGG + Intergenic
956522581 3:70122059-70122081 TTTGTGTGGGACATTTACTTTGG + Intergenic
956814674 3:72897323-72897345 TCTGTGTGGGTGACACTCTCAGG + Intronic
957532747 3:81461216-81461238 TCTGTGTGGCAGATATTCACAGG - Intergenic
959106435 3:102070050-102070072 TCTGTGTGGCAGAGGAACTCTGG - Intergenic
959610249 3:108286018-108286040 TTTCTATGGGAGAAATACTCAGG - Intergenic
959870997 3:111328040-111328062 TCAGATTGGGAGATATGCTCAGG - Intronic
961018642 3:123486007-123486029 TCTGTGGGCCAGATATGCTCTGG + Intergenic
964151628 3:153532249-153532271 TCTGTGTGGGAGATAAGGCCTGG - Intergenic
966579362 3:181542475-181542497 TTTGTTTAGGAGAAATACTCAGG + Intergenic
966615155 3:181905102-181905124 TCTTTTTGGGAGATATATTTTGG - Intergenic
969264028 4:6052896-6052918 TCTTGGTGTGAGAAATACTCAGG + Intronic
974855374 4:67454686-67454708 TTTGTGTGCTAGATATACTCTGG - Intergenic
980890971 4:138815259-138815281 TATGGGTGGTAGATATATTCGGG + Intergenic
980895711 4:138857874-138857896 TCTGCCTGCAAGATATACTCTGG + Intergenic
982655963 4:158150255-158150277 TCTCAGAGGGAGATATTCTCTGG - Intronic
987570857 5:19656061-19656083 TCTGGCTGTGAAATATACTCAGG + Intronic
987791206 5:22570455-22570477 GCTCTGAGGGAGATATACGCAGG - Intronic
990371522 5:55124009-55124031 TCTGTGAGTGACATATATTCTGG + Intronic
991066874 5:62433420-62433442 TCTGTGTGGGAGATATACTCTGG + Intronic
992867479 5:80972185-80972207 TCTGTTGGGTATATATACTCAGG + Intronic
995553588 5:113304324-113304346 TCTGTATGTGAGATGTAATCTGG - Intronic
998822468 5:146069041-146069063 TATGTGTGGGAGAATTACACGGG - Intronic
1000381144 5:160630481-160630503 TTTCTGGGGGAGACATACTCAGG + Intronic
1003399328 6:5778939-5778961 ACTGGGTGGGAGACAGACTCAGG - Intergenic
1004777427 6:18863614-18863636 TCTTTCTGGGTGATATAGTCTGG + Intergenic
1007065429 6:38986116-38986138 TTTCTCTGGGACATATACTCAGG - Intronic
1008077711 6:47163094-47163116 ACTAGGTGGGAGATATATTCTGG - Intergenic
1008930619 6:56935176-56935198 TCTGGGTGGGAGATAAAATTGGG - Intronic
1009195356 6:60678252-60678274 TATGTGTGGGAGCTAAACTTTGG + Intergenic
1011083830 6:83516938-83516960 TGTGTGTGGGAAATATTCACAGG + Intronic
1011101759 6:83729771-83729793 ACTGTTTGGGAGACAAACTCTGG + Intergenic
1011510500 6:88095049-88095071 TCTGTGTGGGAGATGTGCAAGGG + Intergenic
1013711563 6:112906696-112906718 TCTGTGTGGGGGAAATATTATGG + Intergenic
1013855574 6:114568003-114568025 TCTGTTAGGGAGATATTTTCTGG - Intergenic
1016104485 6:140145577-140145599 TCTGTCTGGGGAATATACCCTGG + Intergenic
1017649041 6:156564463-156564485 TCTGAGGAGGAGATTTACTCTGG - Intergenic
1022456729 7:30564408-30564430 GCTGTGTGGGAGCTATGCACAGG - Intergenic
1023139683 7:37089484-37089506 TTTGTGTGGGGGTTATTCTCAGG - Intronic
1024404908 7:48967774-48967796 TCTGTGTGGGAGATGTGCAAGGG + Intergenic
1024808092 7:53172081-53172103 TATGTTTGTGAGATATATTCAGG + Intergenic
1027768695 7:82378976-82378998 TGTGTGTGTGTGTTATACTCGGG + Intronic
1028889454 7:95970754-95970776 TCTTTGAGGGACATTTACTCTGG + Intronic
1030474120 7:110006518-110006540 TCTGTGTGACAGATATTCTAAGG - Intergenic
1031564175 7:123274331-123274353 TCAGTGTAGGAAATAAACTCTGG + Intergenic
1033529555 7:142248357-142248379 TCTGTGTGGGAGAGGCCCTCAGG - Intergenic
1034710614 7:153188203-153188225 TGTGTGTGGGTGATAGGCTCTGG + Intergenic
1035455068 7:159002885-159002907 TCTGTGTGCAAGTTATGCTCAGG + Intergenic
1039975049 8:42356071-42356093 TTTGTGTGCCAGATATAGTCTGG + Intronic
1048549221 8:135418025-135418047 TCTGTCTGGGATATATTTTCAGG - Intergenic
1049918901 9:345239-345261 TCTGTGGGGCAGATAAATTCAGG + Intronic
1052325624 9:27214353-27214375 TGTGTCTGGCAGATCTACTCTGG + Intronic
1052509778 9:29400954-29400976 TTTCTGTGGGACATATACCCAGG - Intergenic
1055522096 9:77091720-77091742 TCTGTGTGAGAGATGATCTCAGG + Intergenic
1057871717 9:98723070-98723092 TCTCTGAAGGATATATACTCAGG + Intergenic
1059093859 9:111391223-111391245 TCTGTGTGGGAAATTTACTGGGG - Intronic
1203581476 Un_KI270746v1:9861-9883 TCTGAGTAAGAGATATAGTCAGG + Intergenic
1186338158 X:8614449-8614471 TCTGTGTGGGAGACTTTCTGTGG - Intronic
1188079883 X:25825992-25826014 CCTGTGTGGGAGAGTTGCTCGGG + Intergenic
1189125014 X:38436871-38436893 CTTGTGTGGCAGATATATTCTGG - Intronic
1192440476 X:71170087-71170109 TCTGAGTTGGAGCTATACCCGGG - Exonic
1196237948 X:113304775-113304797 TATGTGTGGGAGATGTAGTTGGG + Intergenic
1196629663 X:117923201-117923223 TATCTGTGGGAGATATTCTCAGG + Intronic