ID: 991066876

View in Genome Browser
Species Human (GRCh38)
Location 5:62433431-62433453
Sequence GATATACTCTGGGCGCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991066870_991066876 16 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066876 5:62433431-62433453 GATATACTCTGGGCGCCAACTGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991066876 Original CRISPR GATATACTCTGGGCGCCAAC TGG Intronic
920656502 1:207879490-207879512 GAGGTGCTCTGGGCTCCAACAGG - Intergenic
1063355187 10:5392517-5392539 GCTATACTCTTGGCCTCAACCGG - Intergenic
1092076575 12:5678391-5678413 GAGATCCTCAGGGCGCCAACTGG + Intronic
1092159290 12:6307209-6307231 GATATTCCCAGGGAGCCAACAGG + Intergenic
1107037103 13:35912939-35912961 CAGCTACTCTGGGCGCCAGCAGG - Intronic
1108783258 13:53863326-53863348 GATATACCCTGAGAGCCAAAAGG + Intergenic
1110179535 13:72598528-72598550 GCAATACTGAGGGCGCCAACTGG - Intergenic
1116210605 14:41937359-41937381 GATTTACTGTGGACGGCAACAGG + Intergenic
1122674210 14:103397205-103397227 GATATACACGGGGTGCTAACGGG - Intronic
1124796481 15:32786015-32786037 GGTATGCTCTGTGTGCCAACAGG + Intronic
1127863748 15:63014903-63014925 GATAGAGTCTGGGAGCCAATGGG + Intergenic
1131399646 15:92114061-92114083 GATCTCCCCTGGGGGCCAACAGG + Intronic
1138839785 16:60486080-60486102 GATAGATTCTGGGCACCATCTGG - Intergenic
1138915186 16:61455327-61455349 GATATAATCGGGTGGCCAACTGG - Intergenic
1151927128 17:77206361-77206383 GAAATACCCTGGGCGCCCGCAGG - Exonic
1156795344 18:41038531-41038553 GATATACTCTGTTCTCCAGCAGG - Intergenic
1157119659 18:44896998-44897020 AATACACTCTGGGCGACAGCTGG - Intronic
1168283646 19:55320009-55320031 GACAGACCCTGGGCGCCGACTGG + Intronic
936965702 2:118125813-118125835 GATCTACTCTGAGCCCGAACTGG + Intergenic
938292381 2:130157055-130157077 GAGAGGCTCTGGGAGCCAACTGG + Intronic
938464173 2:131515921-131515943 GAGAGGCTCTGGGAGCCAACTGG - Intergenic
946599895 2:221348289-221348311 GAAACACTCTGGGCTCCAAGAGG + Intergenic
1172600178 20:36177873-36177895 GAGATACCCTGGGCTCCACCAGG - Intronic
1175005703 20:55679953-55679975 GATAAACTCTGGGCCACAATAGG + Intergenic
1176974999 21:15310519-15310541 GATATTCACTGGACCCCAACTGG - Intergenic
1184192678 22:42905431-42905453 AATAAACTCTGGGTGTCAACAGG + Intronic
951996516 3:28736175-28736197 GGTATACTCAGGCCGGCAACAGG - Intergenic
956861070 3:73324304-73324326 GCTACACTCTGGGAGCCATCTGG + Intergenic
962443229 3:135442499-135442521 GATATAATATGGCAGCCAACAGG + Intergenic
966891410 3:184409996-184410018 GAAATACTGTGCGTGCCAACGGG - Intronic
991066876 5:62433431-62433453 GATATACTCTGGGCGCCAACTGG + Intronic
1006149442 6:31978828-31978850 GCTATACTCTGGGCGCTCTCAGG - Intronic
1017116869 6:150985986-150986008 GATATACTCTTGGTGCCAAAAGG + Intronic
1033300340 7:140179158-140179180 GATGTCCTCTGGGGGCCACCTGG + Intergenic
1196938092 X:120749479-120749501 GATAGACCCTGGGCAGCAACTGG + Intergenic
1200236756 X:154471466-154471488 GACATACTCAGGGTCCCAACAGG + Exonic