ID: 991066877

View in Genome Browser
Species Human (GRCh38)
Location 5:62433436-62433458
Sequence ACTCTGGGCGCCAACTGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991066870_991066877 21 Left 991066870 5:62433392-62433414 CCAACTGTAGGCACGTTCGTATA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 991066877 5:62433436-62433458 ACTCTGGGCGCCAACTGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991066877 Original CRISPR ACTCTGGGCGCCAACTGGTA TGG Intronic
No off target data available for this crispr