ID: 991074707

View in Genome Browser
Species Human (GRCh38)
Location 5:62522178-62522200
Sequence CAAAATGCTGATCTTGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991074707_991074709 -2 Left 991074707 5:62522178-62522200 CCAACTTCAAGATCAGCATTTTG 0: 1
1: 0
2: 0
3: 17
4: 271
Right 991074709 5:62522199-62522221 TGTCTGTATAAATTTAGGAGCGG 0: 1
1: 0
2: 2
3: 23
4: 247
991074707_991074708 -7 Left 991074707 5:62522178-62522200 CCAACTTCAAGATCAGCATTTTG 0: 1
1: 0
2: 0
3: 17
4: 271
Right 991074708 5:62522194-62522216 CATTTTGTCTGTATAAATTTAGG 0: 1
1: 0
2: 6
3: 55
4: 542
991074707_991074711 20 Left 991074707 5:62522178-62522200 CCAACTTCAAGATCAGCATTTTG 0: 1
1: 0
2: 0
3: 17
4: 271
Right 991074711 5:62522221-62522243 GACACTAAAAAGCTGAGTGGAGG No data
991074707_991074710 17 Left 991074707 5:62522178-62522200 CCAACTTCAAGATCAGCATTTTG 0: 1
1: 0
2: 0
3: 17
4: 271
Right 991074710 5:62522218-62522240 GCGGACACTAAAAAGCTGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 136
991074707_991074712 21 Left 991074707 5:62522178-62522200 CCAACTTCAAGATCAGCATTTTG 0: 1
1: 0
2: 0
3: 17
4: 271
Right 991074712 5:62522222-62522244 ACACTAAAAAGCTGAGTGGAGGG 0: 1
1: 0
2: 3
3: 18
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991074707 Original CRISPR CAAAATGCTGATCTTGAAGT TGG (reversed) Intronic
901778040 1:11574154-11574176 CAAAATGATGATCTTGGATGGGG - Intergenic
902933544 1:19747696-19747718 CAAAATGATCATTTTGAAGATGG + Intronic
903249165 1:22039949-22039971 CAGAATGGTGATTTTGAAGCTGG + Intergenic
903348681 1:22704499-22704521 CAGAAGGCTGGTCATGAAGTGGG + Intergenic
905703117 1:40033963-40033985 AAACATCCTGATCTAGAAGTGGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909174910 1:72345091-72345113 CAAAATTTTGATTGTGAAGTAGG + Intergenic
909219496 1:72937500-72937522 AAAACTGCTAATCTTCAAGTAGG - Intergenic
909827537 1:80144080-80144102 CAAAATACTGATTTTAAAGAAGG + Intergenic
910043689 1:82886522-82886544 CATGATGCTGATCTGGGAGTAGG + Intergenic
910391508 1:86750011-86750033 CAAAATCCTGTCCTTCAAGTTGG - Intergenic
911701676 1:100960423-100960445 CAAAGTGCTGGTCATAAAGTGGG - Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912916259 1:113817729-113817751 GAAAATGCTGCTTTTTAAGTAGG + Intronic
916777880 1:167987805-167987827 TAAAATGTTAATATTGAAGTTGG + Intronic
917191833 1:172426246-172426268 CACACTGCTGAGCCTGAAGTGGG + Intronic
918478153 1:184948079-184948101 CAATATGCTTATCTGGGAGTAGG - Intronic
918605557 1:186421188-186421210 CAAAAGGATGATCTTCAAGAAGG + Exonic
924778682 1:247128661-247128683 CAAAATGCTGGTCAGGCAGTCGG + Intronic
924782972 1:247169757-247169779 CAAAATGCTGGTCAGGCAGTCGG - Intronic
1063522583 10:6754428-6754450 CCGACTGCTGATCTTGAACTTGG - Intergenic
1065366856 10:24945244-24945266 CAGAATGCTGATCTGGAATATGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068267934 10:54678682-54678704 ATAAATGATGATCTTGAAGGTGG - Intronic
1069676533 10:70252844-70252866 TCAAATGCTGATCTTGTACTTGG + Exonic
1069965904 10:72116245-72116267 AAGAATGCTTTTCTTGAAGTAGG - Intronic
1070009504 10:72458525-72458547 CAACATGATGATTGTGAAGTTGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073523328 10:104155519-104155541 CATAATGGTCATCTTGAAGGGGG + Intronic
1074391049 10:113058401-113058423 CCAAATGCTGTTTTTGGAGTGGG + Intronic
1076221919 10:128740569-128740591 GGAAATGATGATCTTCAAGTAGG + Intergenic
1078013968 11:7596494-7596516 AAAAATGGAGATCTTAAAGTAGG + Intronic
1078277219 11:9861169-9861191 CAAAATTCTAAACTTGTAGTGGG - Intronic
1078837048 11:15040978-15041000 TAAATTACGGATCTTGAAGTGGG - Intronic
1079276048 11:19038691-19038713 CAAAATGCTCACCTTGAACATGG - Intergenic
1081632124 11:44696275-44696297 CTAAATGATGATCTTGAAAAGGG - Intergenic
1083982449 11:66184021-66184043 CAAAATGATGGTCGTGAGGTAGG - Intronic
1087183812 11:95164437-95164459 CAAAAGCCTGATTTTGAATTGGG + Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088028490 11:105216652-105216674 CAAAAGCCTGATCTGTAAGTTGG + Intergenic
1091956905 12:4652537-4652559 CCAAATGCTGAAAGTGAAGTAGG - Intronic
1093067804 12:14676682-14676704 CAAAATGCTGTACATGTAGTTGG + Intronic
1094145693 12:27226384-27226406 AGAAATTCTCATCTTGAAGTGGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095851976 12:46819979-46820001 CAAAATTTTGATTTTAAAGTGGG + Intronic
1096978119 12:55711852-55711874 AAAAATACTGATCTCAAAGTGGG - Intronic
1097051280 12:56224657-56224679 CCAAATTCTGATCCTGAAGTTGG + Exonic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099564725 12:84229118-84229140 AAAAATAGTGAGCTTGAAGTCGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1101079915 12:101172082-101172104 CAAAATCGTGATCTTGAACACGG + Intronic
1101823690 12:108203787-108203809 AGAAATGCTGGGCTTGAAGTTGG - Intronic
1102152978 12:110701403-110701425 CAAGATTCTGATTTGGAAGTTGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104234756 12:126922995-126923017 CACAGTGCAGATCTTGCAGTTGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105925221 13:25001802-25001824 GAAAAGCCTGATCTTGCAGTTGG - Intergenic
1106525281 13:30534925-30534947 GAAAATGCTAATCTAGAAGGTGG - Intronic
1109062643 13:57637018-57637040 CACCATGCTGTTCTTGAAGGTGG + Intronic
1109594887 13:64538373-64538395 CAAAATGCTGATATTAAAGGTGG - Intergenic
1110016368 13:70410428-70410450 TAAAATGCAGATTCTGAAGTTGG + Intergenic
1110201881 13:72860848-72860870 CAAATTGTTGAGCTTGAATTGGG - Intronic
1111089714 13:83427535-83427557 CAACCTGCTGATCTTTAAGAAGG - Intergenic
1112380368 13:98883119-98883141 GTAAATGCTGATCCTGAGGTAGG + Exonic
1112406692 13:99126992-99127014 CAAATTGCTGAGCTTGTAGTGGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114895349 14:26983077-26983099 CAAAAGGCTGGTTTTGCAGTAGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1119213642 14:72851487-72851509 GAAAATGCTTATCATGAAGCAGG + Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120693018 14:87614358-87614380 CAAAATGTTGGTCTTCAAGAAGG - Intergenic
1122038929 14:98968441-98968463 GAAATTGTTGATCTTGAATTTGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1125322930 15:38507903-38507925 CAGAATGGGGATCTTGAAGTCGG + Exonic
1125340480 15:38670656-38670678 CAAAATGCAGATTTTGCAGGCGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127630379 15:60822227-60822249 CAAAATGAGGCTCTTGAACTAGG - Intronic
1128407752 15:67360459-67360481 AAAAGTCCTGAACTTGAAGTAGG + Intronic
1130663342 15:85849170-85849192 CACAAGGCTGAGCATGAAGTAGG + Intergenic
1131492987 15:92879159-92879181 CAAAGTGCTGATCTTTAGGAGGG - Intergenic
1131800306 15:96062014-96062036 CAAAATAGTGATTTTGAAGAGGG - Intergenic
1135107221 16:19660571-19660593 CAAAATGCCAATTTTGAAGGTGG + Intronic
1136525855 16:30829864-30829886 CAGACTGCTGATCTTGAACAAGG - Intergenic
1138047644 16:53742391-53742413 CAAAATCCTGATTTTGACCTGGG - Intronic
1138483616 16:57320642-57320664 CTACAGGCTGATCTTGAACTGGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140468063 16:75197912-75197934 CAAAATGCGGATGCTGAGGTGGG - Intergenic
1141171906 16:81696783-81696805 CACAGTGCTGATCATGAAGGTGG + Intronic
1141783982 16:86186095-86186117 CAAAACACTGAACTAGAAGTAGG + Intergenic
1144297834 17:13896019-13896041 CAAAAAGCTAAACTTGAATTTGG - Intergenic
1149451109 17:56750662-56750684 CAAACAGCTGATCTTGGAGAGGG + Intergenic
1149812045 17:59685014-59685036 CAAAATACTGATCTGGCATTTGG + Intronic
1153060526 18:990388-990410 CAAAATGCTGTTCCTGCAGCAGG + Intergenic
1153618972 18:6958478-6958500 CAAAAACCTGATCTTCAATTTGG - Exonic
1153726219 18:7958259-7958281 CAAAATGCCCATATTGAAGGAGG + Intronic
1154092484 18:11378478-11378500 CACAATGGGGACCTTGAAGTAGG - Intergenic
1154254653 18:12771913-12771935 CAGAAAGCTTATCTGGAAGTTGG + Intergenic
1155203352 18:23536573-23536595 CAAGATGCTGATTTTCAGGTTGG - Intronic
1155981471 18:32184622-32184644 CAAAATGCTGTTGCTAAAGTGGG - Intronic
1156058668 18:33045403-33045425 CAAAGTGCTGAGCATGTAGTGGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1163241712 19:16067642-16067664 GAAAATGCAGATGCTGAAGTTGG + Exonic
1163697933 19:18773382-18773404 CAGAAAGGTGAGCTTGAAGTTGG - Intronic
1163920237 19:20281611-20281633 CAAAATACTGATCTTGTGGAGGG + Intergenic
1165611466 19:37157003-37157025 CAAAATGCAAATCATGAACTAGG + Intronic
1166512011 19:43415312-43415334 CACACTCCTGATCCTGAAGTTGG + Intronic
1167770714 19:51514699-51514721 CAAACTGCCCATCATGAAGTAGG + Intergenic
1167895104 19:52574206-52574228 AGAAATGCTGATCTTGGAGTTGG + Intronic
1167992522 19:53372340-53372362 AGAAATGCTGACCTTGGAGTTGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925485910 2:4330920-4330942 CAAATTGCTGATTTTGCAGGGGG + Intergenic
926233494 2:11022341-11022363 CAAACTGAAGATTTTGAAGTTGG + Intergenic
927110198 2:19859064-19859086 CCAAATGCTGATCTTTATTTGGG + Intergenic
927533250 2:23830349-23830371 CAAAATTCTGATCTTACCGTTGG - Intronic
928422670 2:31151056-31151078 AAAAATGCTGATTTTGCAGCTGG - Intronic
928807587 2:35179090-35179112 CAAACAGCTGACCTTAAAGTAGG - Intergenic
929231712 2:39567132-39567154 CAAAATGCTCTTCTAAAAGTAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931390422 2:61837967-61837989 AAAAATGTTGATGTTTAAGTAGG - Intronic
931803052 2:65777473-65777495 TAAAATGCAAATTTTGAAGTCGG - Intergenic
932259362 2:70314066-70314088 CAAAATGCTGAGATTGAGGCAGG + Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
934722241 2:96588334-96588356 CAGAATTCTGTTCTTGAATTTGG - Intergenic
936031300 2:109072878-109072900 CAAAATGCTGTTCTTGTTCTTGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938410757 2:131061872-131061894 AAAGATGCTGATCTGGAAGATGG + Intronic
938576359 2:132608066-132608088 GAAATTGCTGATCTTCCAGTAGG - Intronic
939318596 2:140585524-140585546 CAAATGGCTGATCTTAGAGTTGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939642047 2:144652256-144652278 CAGAATGCTGTGCTTGAAGTGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942886300 2:180928250-180928272 TAAGATACTTATCTTGAAGTTGG + Intergenic
944618148 2:201483617-201483639 CAAATTGCTGACTTTGAAGATGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946888079 2:224244771-224244793 CTAAATGGTGATCCTGAAGAAGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1168952483 20:1811848-1811870 CAAATTCCTGGGCTTGAAGTGGG - Intergenic
1169831918 20:9835110-9835132 TAAAAATCAGATCTTGAAGTTGG + Intronic
1169873983 20:10276121-10276143 CATATTACTGATCATGAAGTTGG - Intronic
1172050915 20:32117294-32117316 GAAAATGCTGCTTTTGCAGTAGG + Intronic
1172928898 20:38567670-38567692 CAAAAAGCTCCTCTTGTAGTAGG - Intronic
1173779050 20:45738044-45738066 GAAAATGCTGATCATGGAGCAGG - Intergenic
1175556486 20:59862615-59862637 GAAAATGCTGGTCTTGATGCAGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177811029 21:25925180-25925202 CAAAATGCCTAGCTGGAAGTGGG - Intronic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178264872 21:31133563-31133585 GAAAATGCTGGTTTTGAGGTTGG - Intronic
1179005980 21:37515434-37515456 CAAAATGCTCATATTTTAGTTGG + Intronic
1179280977 21:39934023-39934045 CAAGATGATGATATTGAAGTGGG - Intergenic
1181781635 22:25198002-25198024 CAAAGTGCTGAGCGTGCAGTAGG + Intergenic
1185152493 22:49172405-49172427 CAAACTGCTGGTCTTGGAGTAGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
953050074 3:39332924-39332946 TAAAATGTTCATTTTGAAGTTGG - Exonic
953366792 3:42352125-42352147 CAAATTAAGGATCTTGAAGTGGG - Intergenic
956482084 3:69683175-69683197 CATATTTCTGATCTTCAAGTAGG + Intergenic
956645299 3:71449290-71449312 GTCAATGCTGATCTTGAACTTGG - Intronic
957226410 3:77454075-77454097 GAAGATGCTAATCTTGAAGAAGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958551524 3:95620010-95620032 CAAAATGGTGATTCTGAAATTGG + Intergenic
959158602 3:102696749-102696771 CACACTGCTGGGCTTGAAGTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960801874 3:121548013-121548035 CAAAATGCTGAATTTAAATTGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963565441 3:146923503-146923525 AAAAATGCTTTTCTTGAATTTGG + Intergenic
964531158 3:157669323-157669345 CAAAATGCTTGGCTTGGAGTTGG + Intronic
965394879 3:168151411-168151433 CAAAATACTGATTTTAAAGAAGG - Intergenic
965541379 3:169875010-169875032 GAAAATGTTGATGGTGAAGTGGG + Intergenic
965779239 3:172266682-172266704 GAAGATGCTGGTCTTGAAGCTGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969291742 4:6244556-6244578 GCAAATGCTGATCTTGGGGTTGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970630369 4:17936455-17936477 AAAAATACTGATCTGGAAGATGG - Intronic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971724687 4:30295377-30295399 CAAAATGCCCTTATTGAAGTAGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973986592 4:56360362-56360384 GGAAATGATGATCTTGAAGTAGG - Intronic
974233112 4:59143450-59143472 AAAAATGTTGATCTTTAATTGGG + Intergenic
975656128 4:76642786-76642808 CAAAATGCTGATCTGGGTGGGGG + Intronic
977172351 4:93779174-93779196 CAAAATGATTATTATGAAGTAGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978450297 4:108826015-108826037 AAAGATGCTGATTTTGAAATAGG - Intronic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
980807286 4:137830274-137830296 CAAAATATTGATCTCCAAGTAGG + Intergenic
981299911 4:143175469-143175491 CAACAGGCTGGTCTTGAACTTGG - Intergenic
982561975 4:156940190-156940212 GGAAAGGCTGATCTTGAAATTGG - Intronic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984654700 4:182305404-182305426 CAAAATGTTTATTTCGAAGTAGG + Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986876327 5:12115452-12115474 CAAAATCTTGATGTTGAAGATGG + Intergenic
987312974 5:16698490-16698512 GCAAATGCTCATCATGAAGTAGG + Intronic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
988995287 5:36709165-36709187 CTCAGTGGTGATCTTGAAGTGGG - Intergenic
988995522 5:36711358-36711380 GAAAATGCTGCTATTGAAATGGG - Intergenic
989242559 5:39217667-39217689 CAAGATCCTGAGCTTGAAGGTGG - Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990965184 5:61438830-61438852 CAACCTGCTGTTCTTGGAGTTGG - Intronic
991074707 5:62522178-62522200 CAAAATGCTGATCTTGAAGTTGG - Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991608871 5:68430090-68430112 CAGAAAGCTGATCTTGTAATTGG - Intergenic
992006964 5:72487660-72487682 CAATATGCTTATCTGAAAGTGGG - Intronic
992300426 5:75372931-75372953 CACAATGAAGATTTTGAAGTGGG + Exonic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
994115593 5:96058547-96058569 AAGAAAGCTGATTTTGAAGTGGG + Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994680796 5:102884655-102884677 CCAAATGCTTTTCTTGAAGAGGG - Intronic
995591386 5:113703947-113703969 CAAAATGAAGATATTGAAATGGG - Intergenic
995805569 5:116048291-116048313 CAAGATGCTCATCTTCAAGCAGG - Intronic
996026426 5:118651219-118651241 CAAAACGCTGATGTTTAAGCAGG - Intergenic
996431948 5:123390588-123390610 CAAAAAGCTGATCTTTATGCAGG - Intronic
996502345 5:124230761-124230783 CCAAATGCTGGTAGTGAAGTAGG - Intergenic
997835136 5:137186087-137186109 GAAAATCCTGATCTGGAGGTGGG + Intronic
1000464236 5:161555417-161555439 CAGAATGATGATTTTGAAGAAGG + Intronic
1004921585 6:20381141-20381163 CAAAATGTTCCTCCTGAAGTTGG + Intergenic
1005194316 6:23265373-23265395 CACAAGTCTGATCTTGAGGTAGG - Intergenic
1005801074 6:29425681-29425703 CAAAATGTTGATGTTGAAGCTGG + Exonic
1006064330 6:31452536-31452558 CAAAATGCTGAGATTGCAGGTGG + Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015426392 6:133073723-133073745 CAAAATCCTCATCATGAAATAGG - Intergenic
1016266779 6:142241911-142241933 TAAAATGCTTAGCTTGGAGTGGG + Intergenic
1016851365 6:148622545-148622567 TAAAATGCTGATCATGACCTGGG + Intergenic
1017561724 6:155635467-155635489 CAAATTGCTGATATTGTGGTGGG + Intergenic
1019089612 6:169517424-169517446 CAAAATGATGATGTGGAAGCAGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020386160 7:7605060-7605082 CAAAAGGATAATCTTGCAGTCGG - Intronic
1022282281 7:28923447-28923469 CAAAGTGCTGATCAGGAAGAAGG + Intergenic
1022603850 7:31789059-31789081 GAATATGCTGATGATGAAGTGGG - Intronic
1026075519 7:67163642-67163664 CAAATTTCTGATCTTTAAGCAGG + Intronic
1026431739 7:70354527-70354549 CAAATTGCTCATCTTTAAGTTGG - Intronic
1026656700 7:72262867-72262889 CAAAGTGCTGAGGTTGAAGTGGG + Intronic
1026701336 7:72648569-72648591 CAAATTTCTGATCTTTAAGCAGG - Intronic
1027378453 7:77577925-77577947 CAAAATGTTGATAATGAAGCTGG + Intronic
1028325252 7:89516237-89516259 TAAAATCCTCATCTTTAAGTTGG - Intergenic
1028768812 7:94591584-94591606 CCAAATGCTGATTTTGAATTTGG - Intronic
1028867155 7:95726662-95726684 TAAAAAGCTGATCTTAAAATAGG - Intergenic
1028893321 7:96013056-96013078 CAAATTGAGGATCTTGAAATGGG + Intronic
1028909971 7:96196777-96196799 CAGAATGCTGCTTTTAAAGTTGG - Intronic
1030943478 7:115684913-115684935 AAAAATTCTGACCTTGAAATCGG + Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031331884 7:120475400-120475422 CAAAATGCTTACCTTGTAGTAGG + Intronic
1033266089 7:139888455-139888477 CAAAATCCTGTTCTTGCAATTGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034942778 7:155242333-155242355 AAAACTGCTGATCCTGAAATAGG - Intergenic
1042572151 8:70177345-70177367 CAAAAAGCTTACCTTCAAGTCGG - Intronic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046673811 8:117087025-117087047 CTAAATGCTGACCCTGAAGAAGG - Intronic
1050227243 9:3473867-3473889 CAAAATACTGCTGTTGAAATAGG + Intronic
1050596625 9:7210976-7210998 CAAAAGGCTGCCCTTGAGGTAGG + Intergenic
1051403261 9:16706538-16706560 CAAAATGATGATCTCAAAGCAGG + Intronic
1051955252 9:22685140-22685162 CAACAGTCTGATCTTGCAGTGGG + Intergenic
1052745261 9:32434171-32434193 GAAACTGATGATCTAGAAGTTGG + Intronic
1053552439 9:39098080-39098102 CTAAATTCTGACCTTGAAGGAGG - Intronic
1053816560 9:41918244-41918266 CTAAATTCTGACCTTGAAGGAGG - Intronic
1054106823 9:61061926-61061948 CTAAATTCTGACCTTGAAGGAGG - Intergenic
1054614034 9:67269199-67269221 CTAAATTCTGACCTTGAAGGAGG + Intergenic
1055249439 9:74284634-74284656 CAAAATGCTGATGTCAAAGAAGG - Intergenic
1056331734 9:85526702-85526724 CAACATGCTGAACTTGATTTTGG + Intergenic
1057570512 9:96200928-96200950 GAAAGTGCTAATTTTGAAGTAGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059965641 9:119610791-119610813 CAAAAGGGTGATCTTGTACTTGG - Intergenic
1060077487 9:120605445-120605467 CAAAATGATGATGTTAAATTGGG + Exonic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185954405 X:4473634-4473656 TAAAATGTTGCCCTTGAAGTAGG - Intergenic
1186126047 X:6414970-6414992 CAAAATGTTGTTATTGAATTTGG - Intergenic
1187000030 X:15167183-15167205 CAAATTTCTGATCTTTAAATTGG - Intergenic
1189460602 X:41239663-41239685 AAAAATTCTGATCTTGGATTGGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1190643967 X:52507492-52507514 CAACATTCTGTTCTTGATGTTGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1197704284 X:129622789-129622811 CAAAAGGCAGGTCTTGAGGTTGG - Intergenic
1198954225 X:142109942-142109964 CAAAATGCATATCTTGATCTTGG + Intergenic
1201227704 Y:11834360-11834382 AGAAATGCTGGTCATGAAGTTGG + Intergenic
1201747298 Y:17391546-17391568 CAAAATGCTGATTTTATTGTGGG + Intergenic