ID: 991076906

View in Genome Browser
Species Human (GRCh38)
Location 5:62550436-62550458
Sequence GTTTTCAAGGGTATTATAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991076899_991076906 19 Left 991076899 5:62550394-62550416 CCAATACTAGGTCCACAAATGTT 0: 1
1: 0
2: 0
3: 13
4: 113
Right 991076906 5:62550436-62550458 GTTTTCAAGGGTATTATAGAAGG 0: 1
1: 0
2: 2
3: 15
4: 218
991076900_991076906 7 Left 991076900 5:62550406-62550428 CCACAAATGTTTCAACCGATTTT 0: 1
1: 0
2: 1
3: 11
4: 185
Right 991076906 5:62550436-62550458 GTTTTCAAGGGTATTATAGAAGG 0: 1
1: 0
2: 2
3: 15
4: 218
991076898_991076906 20 Left 991076898 5:62550393-62550415 CCCAATACTAGGTCCACAAATGT 0: 1
1: 0
2: 3
3: 11
4: 107
Right 991076906 5:62550436-62550458 GTTTTCAAGGGTATTATAGAAGG 0: 1
1: 0
2: 2
3: 15
4: 218
991076901_991076906 -8 Left 991076901 5:62550421-62550443 CCGATTTTACCCTATGTTTTCAA 0: 1
1: 0
2: 2
3: 21
4: 388
Right 991076906 5:62550436-62550458 GTTTTCAAGGGTATTATAGAAGG 0: 1
1: 0
2: 2
3: 15
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991076906 Original CRISPR GTTTTCAAGGGTATTATAGA AGG Exonic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902140586 1:14350430-14350452 GTTTACAAGGTTATTAGTGATGG - Intergenic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
905631116 1:39519098-39519120 GTGTTCAAGGGTCTTATGGGGGG - Intronic
905666643 1:39767073-39767095 GTGTTCAAGGGTCTTATGGGGGG + Intronic
906697603 1:47833992-47834014 GTTTTCAAGGATACTGCAGAAGG - Intronic
908960405 1:69690809-69690831 CTTTTTAAGGGAATCATAGAGGG + Intronic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
911025428 1:93431233-93431255 TTTTTCAATGTTATTATAAATGG - Intergenic
911372470 1:97010518-97010540 ATTTTCAAGGGTAATTTTGATGG - Intergenic
911864302 1:102996839-102996861 TTTTTCATGTGTATTATATATGG - Intronic
912111737 1:106350565-106350587 GTCTTCTAGGGGTTTATAGAGGG + Intergenic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
916529276 1:165640360-165640382 GTTTTCAGGGGTGGTACAGAAGG + Intronic
919033349 1:192274222-192274244 GATTTCAAGGGTAATCTACATGG + Intergenic
923277741 1:232413387-232413409 TTTTTCCAGGGGATTAGAGAAGG - Intronic
923896980 1:238281868-238281890 GTTTTCTAGAATATTCTAGAAGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924190573 1:241547821-241547843 TTTTTCAAGGGTTCTATACATGG - Intronic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1064167533 10:12999795-12999817 GTTTTGAATAGTTTTATAGATGG + Intronic
1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG + Intergenic
1069248236 10:66235313-66235335 GTTTTTAAAGGTATTATCTATGG + Intronic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1072408577 10:95178346-95178368 GTTTACATGGGTATTTTAGATGG - Intergenic
1078058385 11:8027016-8027038 TTTTTCAATGATATTATAAAAGG + Intronic
1078442570 11:11379429-11379451 GTTTTGAAGGGAAAAATAGAGGG + Intronic
1080210862 11:29783230-29783252 TTTATCAAGGCTTTTATAGAAGG + Intergenic
1081341290 11:41930897-41930919 GTTTTGAAAGATATTAAAGATGG - Intergenic
1081459776 11:43261570-43261592 GTTTTAAAAGGTATGATGGAGGG + Intergenic
1081818577 11:45968615-45968637 ATTTTTAAGAGTATTAGAGAAGG - Intronic
1082664744 11:55961857-55961879 ATTCTCCAGGGAATTATAGATGG - Intergenic
1086390357 11:86357127-86357149 GTTTACAAGGGTATTATTACAGG - Intergenic
1090935782 11:131340817-131340839 ATATTCAAGGGAACTATAGATGG - Intergenic
1091464508 12:671949-671971 GTTTTTAAAGATATTTTAGATGG + Intergenic
1092728064 12:11503952-11503974 TTTTTCAGAGGTATTATAAATGG + Intergenic
1093723053 12:22467851-22467873 GTTTTCAAAGGAATTATAACTGG - Intronic
1099019866 12:77390244-77390266 GCTTTGAAGGGTATTCTAGATGG - Intergenic
1099830320 12:87833936-87833958 TTTTAAAAGGGTAATATAGAAGG + Intergenic
1104626792 12:130363323-130363345 GTGTTGAGGGGTAGTATAGAGGG + Intronic
1105404702 13:20123744-20123766 ATTTTCAGGGGTTTTATACAGGG + Intergenic
1107427335 13:40306955-40306977 GTTTTCAAGGATAGTTTAGTGGG + Intergenic
1108200199 13:48035619-48035641 GTTTTTTATGGTATTATAAATGG + Intergenic
1108729609 13:53220738-53220760 GTTTTCTAGCGTTTTATAGATGG - Intergenic
1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
1109147107 13:58792571-58792593 ATTTTCAAGAATTTTATAGAGGG - Intergenic
1111225249 13:85262482-85262504 TTTTCCAAGGATATTTTAGAAGG + Intergenic
1111558129 13:89908348-89908370 ATGTTCAAGGATATCATAGAGGG + Intergenic
1112247703 13:97749512-97749534 GTTTTCAAGGGTTTTGGAGCAGG + Intergenic
1112717155 13:102200277-102200299 GTTTTCAAAGTTATTATATGTGG - Intronic
1114593178 14:23887973-23887995 GTTTTCGATGCTATTATAAATGG - Intergenic
1118924738 14:70181792-70181814 GTTTACAAGGGCATTTTAGGAGG + Intronic
1120602727 14:86531996-86532018 TCTTTCAAAGGTATTTTAGAGGG + Intergenic
1121599119 14:95190066-95190088 GCTGTCAAGGGTATTTCAGAAGG + Exonic
1121712384 14:96048407-96048429 CTTTTCCAGGGTATCATAGTTGG + Intronic
1124097479 15:26662061-26662083 GTTTTGATGGTTATTAAAGATGG - Intronic
1124189234 15:27557936-27557958 ATTATCAAGGTTATTATACAAGG - Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124219155 15:27834404-27834426 ATTTTAAAGGGTATTATAAAGGG - Intronic
1124417841 15:29488827-29488849 TTTTTCAAGGGTATTTTTGTAGG - Intronic
1126226926 15:46281588-46281610 GTTCTCAAGGGTATTGTACTCGG - Intergenic
1128076488 15:64829561-64829583 GTTTTCAAGGTCATTATGGTAGG + Intergenic
1128094749 15:64945295-64945317 GTTTTCAAAGTTAATACAGATGG + Intronic
1128507145 15:68281520-68281542 GTTTCCTAAGGTATTATAGAAGG - Intronic
1130647143 15:85738468-85738490 GTTTTTAAATGTATTATAAAAGG + Intronic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136359863 16:29772055-29772077 GCTTTCAGGGGAATTCTAGATGG + Intergenic
1138721458 16:59086913-59086935 AATTTCAAGGGTATTTTATATGG + Intergenic
1139501040 16:67366070-67366092 TTCTTGAAGGGTATTTTAGATGG + Intronic
1140991160 16:80212991-80213013 GTTTTAAGGCTTATTATAGAAGG - Intergenic
1141297898 16:82786895-82786917 GTTTTTAAGGGTATTGGACAAGG + Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149280553 17:55100636-55100658 GTTTTTAAAGGTAATATAAAGGG + Intronic
1149816118 17:59725376-59725398 GTTTTCAAGGGAATTTTGAAAGG + Intronic
1151255505 17:72873380-72873402 TTTTTCAAGGGTAGTTTAGCAGG - Intronic
1151706597 17:75772303-75772325 GTTATCATGAATATTATAGAAGG - Intergenic
1152582845 17:81175166-81175188 CTTTTCAATGGTACTATACATGG - Intergenic
1153519031 18:5934609-5934631 ATTTTAGAGGGTATTTTAGAGGG + Intergenic
1153937649 18:9944223-9944245 GATTTCAGGGGTCTTATAAAGGG + Intronic
1156387304 18:36617348-36617370 GTTTTCAAGCTTTTTATAAATGG + Intronic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159173795 18:64808454-64808476 GTTTTCATAGGTGATATAGATGG - Intergenic
1159219683 18:65443264-65443286 ATTTTCAAGGTTACTATACATGG - Intergenic
1159869545 18:73744791-73744813 GTTTTTAAGGCTATTACAAAAGG - Intergenic
926667399 2:15541113-15541135 GTTTTCAAGGGTGTCAAGGAAGG - Intronic
927192465 2:20526095-20526117 GTTTTCAAGATAACTATAGAAGG - Intergenic
927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
932546286 2:72714034-72714056 GCTTTCAAGGGTACCACAGAAGG - Intronic
933115918 2:78471296-78471318 GTCTTTAGGGGTATCATAGAAGG - Intergenic
934144899 2:89082512-89082534 GATTTGAAGGGTATTTTCGATGG + Intergenic
934219991 2:90073861-90073883 CTTTTCACGGGTATTAATGAAGG - Intergenic
934224361 2:90118040-90118062 GATTTGAAGGGTATTTTCGATGG - Intergenic
935303678 2:101716536-101716558 GTTTTCATGGGGTTTAAAGAAGG + Intronic
935704229 2:105841797-105841819 GTTTTATACGGTATCATAGAAGG + Intronic
937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG + Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
938640030 2:133267882-133267904 GTTTTCAAGTATAATATAAATGG + Intronic
940311846 2:152287557-152287579 GTTTTCAATTGTATAATAAAAGG - Intergenic
940321649 2:152383788-152383810 GTCTTCAAGGGTTTTATTTATGG + Intronic
940637723 2:156319288-156319310 GTTTTCAAAGATATTATATTGGG - Intergenic
943151653 2:184121605-184121627 ATTTTCTAGGGTATTAAAGAGGG + Intergenic
943409674 2:187531840-187531862 GTATTTAAGTGTATTATAAAAGG - Intronic
943526677 2:189025233-189025255 ATTTCCAAGGGTACTCTAGAGGG + Intergenic
946587347 2:221204834-221204856 TTTTTTAAGGTTGTTATAGATGG + Intergenic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1169583421 20:7052282-7052304 ATTTTTAAGGCTATTATAAAAGG + Intergenic
1170208421 20:13823982-13824004 GTGTTCAAGGGTATGGTGGAAGG - Intergenic
1178882477 21:36460421-36460443 GTTTTCAAGCGTCTTACAGATGG + Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1184338012 22:43866657-43866679 GTTTTCAATGCTATTAAAAATGG - Intergenic
949236079 3:1810144-1810166 GGTTTCAGGGTTCTTATAGATGG + Intergenic
953218306 3:40943277-40943299 GTTTTCTATGCTATTATAAATGG + Intergenic
956042648 3:65161270-65161292 GTTTTCAAGGCTACTATGGCTGG + Intergenic
958086259 3:88811609-88811631 GTTTTCATGGGATTTATAGTAGG + Intergenic
960277483 3:115744433-115744455 GTTTTATAGGGTATTTTATAGGG + Intergenic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
963968187 3:151397872-151397894 GTTTTGAAGGTTAATATAAATGG - Intronic
964377411 3:156062785-156062807 ATTTTTAATGCTATTATAGATGG + Intronic
968010546 3:195271250-195271272 GGTTCCAAGGGTATTAGAGGAGG + Intergenic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
970593014 4:17576063-17576085 GTTTTTAAGGGTTTTGGAGAGGG - Intergenic
974475286 4:62371116-62371138 GTTTTCAAGGTCATCATGGAGGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974650740 4:64750670-64750692 GTTTTTAAGGGTTTTAGAGTGGG + Intergenic
977020419 4:91752231-91752253 CTTTTAAAGGGGATTATAAATGG + Intergenic
977093693 4:92712828-92712850 ATATTCAAGGGAATTATTGATGG - Intronic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979057051 4:116009019-116009041 ATTTTCAAAGGTTTTATATATGG - Intergenic
979286274 4:118928437-118928459 GTTTTAAAGTTTAGTATAGAAGG - Intronic
980429555 4:132675803-132675825 GTTTTCAAGTGAATGATGGAGGG + Intergenic
980967214 4:139533761-139533783 GTTCTCAAGGGTCTTTCAGATGG + Intronic
981495794 4:145390835-145390857 GTTTTCACGGCTGTAATAGATGG + Intergenic
982145598 4:152386555-152386577 TTTTCCAAAGTTATTATAGATGG - Intronic
983282325 4:165696338-165696360 GTTATCCAGTGGATTATAGATGG + Intergenic
983339489 4:166440447-166440469 GTTTTCAAAGATACTATAAATGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
985044850 4:185930151-185930173 GTTTTCAGGGATATTTTAAATGG + Intronic
985159910 4:187033944-187033966 GTCTTCAAGGGTGTGATGGAAGG - Intergenic
986564845 5:9101827-9101849 GGTTTCAAGGGTATTATTAAGGG + Intronic
987569711 5:19640315-19640337 GATTACAAGGGTATTATATGTGG + Intronic
987688917 5:21242533-21242555 TTTTTCCAGGTTTTTATAGATGG + Intergenic
987721814 5:21645528-21645550 ATTTTGAAAGGTATTATTGATGG + Intergenic
987905802 5:24075388-24075410 CTTTTCAAAGGCATTATGGAGGG + Intronic
988167989 5:27618804-27618826 GTTTTCAAAGATAATATAAATGG + Intergenic
988261937 5:28898034-28898056 ATTTTCCAGGGTATCAGAGATGG - Intergenic
988936886 5:36092841-36092863 TTTTTCAAGGGTAATATATCTGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
991076906 5:62550436-62550458 GTTTTCAAGGGTATTATAGAAGG + Exonic
992749122 5:79846110-79846132 GTTTTCATGGATATTATTCAGGG - Intergenic
992766876 5:80009388-80009410 GTTTTCTTGGGTAAAATAGAAGG - Intronic
993608884 5:90030774-90030796 GTTTTCAAGGCTAATGTAGCAGG - Intergenic
994676285 5:102826874-102826896 TTTTTCAATGATATTATTGAAGG + Intronic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
996929730 5:128871324-128871346 GTTTTTATGGGTCCTATAGAAGG - Intronic
999896745 5:156042574-156042596 GTTTTCAAGGATAGTTTTGATGG + Intronic
1003101786 6:3181513-3181535 GTATTCAATGGTATTAGGGATGG + Intergenic
1007503507 6:42316492-42316514 GGTTTCAAGAGTATTAATGAAGG - Intronic
1009268210 6:61583962-61583984 GTTTTGAATGCTATTGTAGATGG + Intergenic
1011884258 6:92074469-92074491 ATTTTCAGAGGTATTATTGAGGG + Intergenic
1012105734 6:95155505-95155527 CTTTTCAGGGGAATTATATATGG + Intergenic
1012229258 6:96741130-96741152 TTTTCTAAAGGTATTATAGAAGG + Intergenic
1014533833 6:122593619-122593641 CTTTTCAAAGGCAATATAGATGG + Intronic
1015114585 6:129633751-129633773 GTTTTCAAGTGTATTAAATGAGG + Intronic
1015629620 6:135218782-135218804 GTTTTCAAATGTATTGCAGAAGG - Exonic
1016494119 6:144640292-144640314 CTTATCAAGTATATTATAGATGG + Intronic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1020868403 7:13595377-13595399 GTATTTAAAGGTATTATTGATGG + Intergenic
1020961453 7:14809356-14809378 GTTTTCAAGGTTATGAAACATGG + Intronic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021708069 7:23387692-23387714 GTGTTCATGGGTATTGTAGCAGG - Intronic
1022137690 7:27465096-27465118 GTCTTCATGGGGATTACAGATGG - Intergenic
1022436439 7:30390363-30390385 TTTTTCAAGGGGATTATAAAGGG + Intronic
1022491811 7:30826455-30826477 GTTTGCCAGAGTATTCTAGATGG + Intronic
1023480590 7:40629559-40629581 ATTTTGAAGGCCATTATAGAGGG + Intronic
1023988155 7:45110273-45110295 ATTTTAAAGGGTCTTATAGGGGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1029175867 7:98664117-98664139 GTTTTTAAGGGAATCATAAAGGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1030846654 7:114423187-114423209 GTTACCAAGGGTATAATGGATGG - Intronic
1030976060 7:116124772-116124794 ATTTTCAAAGGCATCATAGAAGG + Intronic
1032215023 7:129951470-129951492 TTTTTGAAGGGTAGTTTAGAGGG - Intronic
1033084166 7:138326757-138326779 GTTTTCAAGGGTAGCCTAGTAGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034072569 7:148200632-148200654 ATTTTGAAGGTTATCATAGAGGG - Intronic
1034935311 7:155195674-155195696 CATTTCAAGTATATTATAGAAGG + Intergenic
1036282636 8:7414784-7414806 TGTTTCAAGGATATTAGAGATGG + Intergenic
1036338837 8:7896765-7896787 TGTTTCAAGGATATTAGAGATGG - Intergenic
1037434886 8:18851893-18851915 GTTTTCAAAGATATTATGAAAGG - Intronic
1039365749 8:36926339-36926361 ATTTTCAAGTTTATTTTAGAGGG + Intronic
1041172467 8:55158594-55158616 GTTTTCTAGGTTATTTTATAGGG + Intronic
1041898139 8:62949917-62949939 GTTTTCAAAAGTATTAGAAAAGG - Intronic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1043126394 8:76401501-76401523 GTTTTAAAGGGAAATAAAGAAGG - Intergenic
1043590055 8:81820841-81820863 GTGTTAAAGGGTATAAAAGAGGG - Intronic
1044253720 8:90034964-90034986 TTTTTGAAGGGTATTTTTGATGG + Intronic
1044279279 8:90337566-90337588 GGTTTCCAGTGTATTGTAGAGGG - Intergenic
1045854892 8:106753558-106753580 ATTTTCAATGGTATTACAAATGG - Intergenic
1046394242 8:113619468-113619490 GTTTTTTAAGGTATTATAAATGG - Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1047331134 8:123887791-123887813 GTTTGCAAGCATGTTATAGATGG + Intronic
1047536062 8:125720502-125720524 GTTTTCATTGGTATTATATGTGG + Intergenic
1048529743 8:135236448-135236470 GTTTTCAAGGGGGTTATTGATGG + Intergenic
1048619675 8:136118137-136118159 CTTTTCTAGGGAATTATAAATGG - Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050049386 9:1583353-1583375 GTTTTCAAGGCTACCACAGATGG + Intergenic
1050224830 9:3441810-3441832 GTTTTATAGAGTTTTATAGAGGG - Intronic
1052128034 9:24803164-24803186 ATTTTCATGGGTATTATCAAAGG + Intergenic
1052879546 9:33592828-33592850 CTTTTCTAGGGCATTACAGAAGG + Intergenic
1053496435 9:38551405-38551427 CTTTTCTAGGGCATTACAGAAGG - Intronic
1054791478 9:69260455-69260477 GTTTGGAAGGGTATTAAAAAGGG + Intergenic
1055240962 9:74185353-74185375 GATTTAATGGGTATTCTAGAAGG + Intergenic
1057676353 9:97138945-97138967 CTTTTCTAGGGTAGTACAGAAGG - Intergenic
1058185981 9:101855411-101855433 GTTATCTAGGAGATTATAGAGGG - Intergenic
1059397398 9:114045973-114045995 ATTTTCAAAGCTATTATAAATGG + Intronic
1059524736 9:114980192-114980214 GTTTACAAGGGGATGAGAGAAGG + Intergenic
1188678677 X:32975024-32975046 AGTTTCAAGGATGTTATAGATGG - Intronic
1191174847 X:57487967-57487989 GTTTTCAAGGTTTATATAAATGG - Intronic
1193076385 X:77360227-77360249 ATGTTCAAGGGTATGAAAGATGG - Intergenic
1193766610 X:85536068-85536090 GTTTTCATAGATATTATAAATGG - Intergenic
1193908487 X:87272228-87272250 TTTTTCCAGGCTATTATAAAAGG + Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1196748561 X:119094047-119094069 CATTTCCAGGGTATTTTAGAGGG - Exonic
1197231868 X:124014115-124014137 ATTTTTAAGCGTATTATAGTAGG - Intronic
1197927401 X:131661429-131661451 GTTCTCAGGGGTAAGATAGATGG + Intergenic
1199623397 X:149718637-149718659 TGTTTAAAGGGTATTATAAAGGG + Intergenic