ID: 991085461

View in Genome Browser
Species Human (GRCh38)
Location 5:62644719-62644741
Sequence AGCCCCGTCCTGTAACATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991085455_991085461 19 Left 991085455 5:62644677-62644699 CCTGGAGGGTCATTCCATATCAA No data
Right 991085461 5:62644719-62644741 AGCCCCGTCCTGTAACATGCAGG No data
991085457_991085461 5 Left 991085457 5:62644691-62644713 CCATATCAATGAGGAACATCTGA No data
Right 991085461 5:62644719-62644741 AGCCCCGTCCTGTAACATGCAGG No data
991085454_991085461 23 Left 991085454 5:62644673-62644695 CCAACCTGGAGGGTCATTCCATA No data
Right 991085461 5:62644719-62644741 AGCCCCGTCCTGTAACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991085461 Original CRISPR AGCCCCGTCCTGTAACATGC AGG Intergenic
No off target data available for this crispr