ID: 991086646

View in Genome Browser
Species Human (GRCh38)
Location 5:62653759-62653781
Sequence TGATTGACCTGACAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991086646_991086648 18 Left 991086646 5:62653759-62653781 CCTCCTGGCTGTCAGGTCAATCA No data
Right 991086648 5:62653800-62653822 TGTTTCATGTCCTTTGTATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991086646 Original CRISPR TGATTGACCTGACAGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr