ID: 991090110

View in Genome Browser
Species Human (GRCh38)
Location 5:62686124-62686146
Sequence TACTATCCACAGCATTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991090108_991090110 0 Left 991090108 5:62686101-62686123 CCGGAGTGAGAAACAAAAGGCTT No data
Right 991090110 5:62686124-62686146 TACTATCCACAGCATTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991090110 Original CRISPR TACTATCCACAGCATTAGCA GGG Intergenic
No off target data available for this crispr