ID: 991091348

View in Genome Browser
Species Human (GRCh38)
Location 5:62696613-62696635
Sequence CCCAGCCAGATTGTTTTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991091342_991091348 20 Left 991091342 5:62696570-62696592 CCAAAGCCATCCTTCATTCTTTG No data
Right 991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG No data
991091341_991091348 21 Left 991091341 5:62696569-62696591 CCCAAAGCCATCCTTCATTCTTT No data
Right 991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG No data
991091345_991091348 -5 Left 991091345 5:62696595-62696617 CCACCACTGAAGCAGATACCCAG No data
Right 991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG No data
991091343_991091348 14 Left 991091343 5:62696576-62696598 CCATCCTTCATTCTTTGCTCCAC No data
Right 991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG No data
991091344_991091348 10 Left 991091344 5:62696580-62696602 CCTTCATTCTTTGCTCCACCACT No data
Right 991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG No data
991091346_991091348 -8 Left 991091346 5:62696598-62696620 CCACTGAAGCAGATACCCAGCCA No data
Right 991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG No data
991091340_991091348 27 Left 991091340 5:62696563-62696585 CCAGAGCCCAAAGCCATCCTTCA No data
Right 991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991091348 Original CRISPR CCCAGCCAGATTGTTTTATG TGG Intergenic
No off target data available for this crispr