ID: 991091647

View in Genome Browser
Species Human (GRCh38)
Location 5:62699249-62699271
Sequence TACAACAGGATGGCAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991091647_991091652 -2 Left 991091647 5:62699249-62699271 CCAGAAGCTGCCATCCTGTTGTA No data
Right 991091652 5:62699270-62699292 TACAAGGCCACAACTGCCTTGGG No data
991091647_991091653 -1 Left 991091647 5:62699249-62699271 CCAGAAGCTGCCATCCTGTTGTA No data
Right 991091653 5:62699271-62699293 ACAAGGCCACAACTGCCTTGGGG No data
991091647_991091655 9 Left 991091647 5:62699249-62699271 CCAGAAGCTGCCATCCTGTTGTA No data
Right 991091655 5:62699281-62699303 AACTGCCTTGGGGAACACAGAGG No data
991091647_991091651 -3 Left 991091647 5:62699249-62699271 CCAGAAGCTGCCATCCTGTTGTA No data
Right 991091651 5:62699269-62699291 GTACAAGGCCACAACTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991091647 Original CRISPR TACAACAGGATGGCAGCTTC TGG (reversed) Intergenic
No off target data available for this crispr