ID: 991092341

View in Genome Browser
Species Human (GRCh38)
Location 5:62705370-62705392
Sequence TAGAAGGCTGAGATGAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991092337_991092341 8 Left 991092337 5:62705339-62705361 CCCTGGAGTTTATCATCAGAGTG No data
Right 991092341 5:62705370-62705392 TAGAAGGCTGAGATGAGGATAGG No data
991092338_991092341 7 Left 991092338 5:62705340-62705362 CCTGGAGTTTATCATCAGAGTGA No data
Right 991092341 5:62705370-62705392 TAGAAGGCTGAGATGAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991092341 Original CRISPR TAGAAGGCTGAGATGAGGAT AGG Intergenic
No off target data available for this crispr