ID: 991093103

View in Genome Browser
Species Human (GRCh38)
Location 5:62711782-62711804
Sequence CAGAGTGTCCACAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991093098_991093103 5 Left 991093098 5:62711754-62711776 CCTTCAATATCAAAATGGCAACA No data
Right 991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG No data
991093097_991093103 6 Left 991093097 5:62711753-62711775 CCCTTCAATATCAAAATGGCAAC No data
Right 991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG No data
991093096_991093103 7 Left 991093096 5:62711752-62711774 CCCCTTCAATATCAAAATGGCAA No data
Right 991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991093103 Original CRISPR CAGAGTGTCCACAGGGAAGT GGG Intergenic
No off target data available for this crispr