ID: 991093941

View in Genome Browser
Species Human (GRCh38)
Location 5:62719734-62719756
Sequence CTGTCTGTGCAGCAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991093936_991093941 16 Left 991093936 5:62719695-62719717 CCTGGCGTGCCTTCAGGCAGCAG No data
Right 991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG No data
991093934_991093941 25 Left 991093934 5:62719686-62719708 CCTCGGGGGCCTGGCGTGCCTTC No data
Right 991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG No data
991093933_991093941 29 Left 991093933 5:62719682-62719704 CCAGCCTCGGGGGCCTGGCGTGC No data
Right 991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG No data
991093937_991093941 7 Left 991093937 5:62719704-62719726 CCTTCAGGCAGCAGAAACACTGC No data
Right 991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991093941 Original CRISPR CTGTCTGTGCAGCAGCAGAG GGG Intergenic
No off target data available for this crispr