ID: 991099443

View in Genome Browser
Species Human (GRCh38)
Location 5:62776469-62776491
Sequence GACTGCTGGTAGTAATATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991099443_991099450 16 Left 991099443 5:62776469-62776491 CCACCATATTACTACCAGCAGTC No data
Right 991099450 5:62776508-62776530 GATTTTAGGAGTCGCCGATCTGG No data
991099443_991099447 -6 Left 991099443 5:62776469-62776491 CCACCATATTACTACCAGCAGTC No data
Right 991099447 5:62776486-62776508 GCAGTCAGGACGTCCTGTCTCGG No data
991099443_991099452 21 Left 991099443 5:62776469-62776491 CCACCATATTACTACCAGCAGTC No data
Right 991099452 5:62776513-62776535 TAGGAGTCGCCGATCTGGTTGGG No data
991099443_991099451 20 Left 991099443 5:62776469-62776491 CCACCATATTACTACCAGCAGTC No data
Right 991099451 5:62776512-62776534 TTAGGAGTCGCCGATCTGGTTGG No data
991099443_991099448 2 Left 991099443 5:62776469-62776491 CCACCATATTACTACCAGCAGTC No data
Right 991099448 5:62776494-62776516 GACGTCCTGTCTCGGATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991099443 Original CRISPR GACTGCTGGTAGTAATATGG TGG (reversed) Intergenic
No off target data available for this crispr