ID: 991100466

View in Genome Browser
Species Human (GRCh38)
Location 5:62786463-62786485
Sequence ATTTAGTTGCTGATTCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991100466_991100468 1 Left 991100466 5:62786463-62786485 CCCTCTTGAATCAGCAACTAAAT No data
Right 991100468 5:62786487-62786509 ATAGCTTTATCAGTCTTCACTGG No data
991100466_991100469 22 Left 991100466 5:62786463-62786485 CCCTCTTGAATCAGCAACTAAAT No data
Right 991100469 5:62786508-62786530 GGTCAAGTGTTTGCTATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991100466 Original CRISPR ATTTAGTTGCTGATTCAAGA GGG (reversed) Intergenic
No off target data available for this crispr