ID: 991112019

View in Genome Browser
Species Human (GRCh38)
Location 5:62911047-62911069
Sequence TTTATCCAGTCCATCATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991112017_991112019 7 Left 991112017 5:62911017-62911039 CCATGGTCTGTATATATACACCA No data
Right 991112019 5:62911047-62911069 TTTATCCAGTCCATCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991112019 Original CRISPR TTTATCCAGTCCATCATCAA TGG Intergenic
No off target data available for this crispr