ID: 991112275

View in Genome Browser
Species Human (GRCh38)
Location 5:62914359-62914381
Sequence GCTGGGGCATGAGACTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991112265_991112275 11 Left 991112265 5:62914325-62914347 CCCACCCTCAAAGTTTCTGATTC No data
Right 991112275 5:62914359-62914381 GCTGGGGCATGAGACTTTTCAGG No data
991112266_991112275 10 Left 991112266 5:62914326-62914348 CCACCCTCAAAGTTTCTGATTCA No data
Right 991112275 5:62914359-62914381 GCTGGGGCATGAGACTTTTCAGG No data
991112268_991112275 6 Left 991112268 5:62914330-62914352 CCTCAAAGTTTCTGATTCAGTAG No data
Right 991112275 5:62914359-62914381 GCTGGGGCATGAGACTTTTCAGG No data
991112267_991112275 7 Left 991112267 5:62914329-62914351 CCCTCAAAGTTTCTGATTCAGTA No data
Right 991112275 5:62914359-62914381 GCTGGGGCATGAGACTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991112275 Original CRISPR GCTGGGGCATGAGACTTTTC AGG Intergenic
No off target data available for this crispr