ID: 991114011

View in Genome Browser
Species Human (GRCh38)
Location 5:62932984-62933006
Sequence ATGTCCTTCAAAAAGAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991114010_991114011 -7 Left 991114010 5:62932968-62932990 CCATGGAAAATGTATGATGTCCT No data
Right 991114011 5:62932984-62933006 ATGTCCTTCAAAAAGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991114011 Original CRISPR ATGTCCTTCAAAAAGAGACA AGG Intergenic
No off target data available for this crispr