ID: 991122760

View in Genome Browser
Species Human (GRCh38)
Location 5:63034488-63034510
Sequence CATTATGAGCAACTTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991122760_991122764 21 Left 991122760 5:63034488-63034510 CCTACCTCAAGTTGCTCATAATG No data
Right 991122764 5:63034532-63034554 AGTTATTCATATTTGCAAATAGG No data
991122760_991122765 22 Left 991122760 5:63034488-63034510 CCTACCTCAAGTTGCTCATAATG No data
Right 991122765 5:63034533-63034555 GTTATTCATATTTGCAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991122760 Original CRISPR CATTATGAGCAACTTGAGGT AGG (reversed) Intergenic
No off target data available for this crispr