ID: 991124383

View in Genome Browser
Species Human (GRCh38)
Location 5:63053059-63053081
Sequence TAGCTTACCTTCTGGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991124383_991124392 17 Left 991124383 5:63053059-63053081 CCAGCTCCCCAGAAGGTAAGCTA No data
Right 991124392 5:63053099-63053121 GTGGCAGCTGCCTCCCAGTGAGG No data
991124383_991124398 30 Left 991124383 5:63053059-63053081 CCAGCTCCCCAGAAGGTAAGCTA No data
Right 991124398 5:63053112-63053134 CCCAGTGAGGGGAAAGGACAAGG No data
991124383_991124393 18 Left 991124383 5:63053059-63053081 CCAGCTCCCCAGAAGGTAAGCTA No data
Right 991124393 5:63053100-63053122 TGGCAGCTGCCTCCCAGTGAGGG No data
991124383_991124394 19 Left 991124383 5:63053059-63053081 CCAGCTCCCCAGAAGGTAAGCTA No data
Right 991124394 5:63053101-63053123 GGCAGCTGCCTCCCAGTGAGGGG No data
991124383_991124395 24 Left 991124383 5:63053059-63053081 CCAGCTCCCCAGAAGGTAAGCTA No data
Right 991124395 5:63053106-63053128 CTGCCTCCCAGTGAGGGGAAAGG No data
991124383_991124389 -2 Left 991124383 5:63053059-63053081 CCAGCTCCCCAGAAGGTAAGCTA No data
Right 991124389 5:63053080-63053102 TAGGTTGGCCCTGCTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991124383 Original CRISPR TAGCTTACCTTCTGGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr