ID: 991127070

View in Genome Browser
Species Human (GRCh38)
Location 5:63081376-63081398
Sequence GTCCCAGGTGATCACCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991127063_991127070 4 Left 991127063 5:63081349-63081371 CCACCATCCTTCCTTAACCCATT No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data
991127062_991127070 5 Left 991127062 5:63081348-63081370 CCCACCATCCTTCCTTAACCCAT No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data
991127058_991127070 18 Left 991127058 5:63081335-63081357 CCCATCTACATCCCCCACCATCC No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data
991127066_991127070 -7 Left 991127066 5:63081360-63081382 CCTTAACCCATTCTCTGTCCCAG No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data
991127061_991127070 6 Left 991127061 5:63081347-63081369 CCCCACCATCCTTCCTTAACCCA No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data
991127057_991127070 28 Left 991127057 5:63081325-63081347 CCTTATTTTGCCCATCTACATCC No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data
991127060_991127070 7 Left 991127060 5:63081346-63081368 CCCCCACCATCCTTCCTTAACCC No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data
991127064_991127070 1 Left 991127064 5:63081352-63081374 CCATCCTTCCTTAACCCATTCTC No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data
991127059_991127070 17 Left 991127059 5:63081336-63081358 CCATCTACATCCCCCACCATCCT No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data
991127065_991127070 -3 Left 991127065 5:63081356-63081378 CCTTCCTTAACCCATTCTCTGTC No data
Right 991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991127070 Original CRISPR GTCCCAGGTGATCACCTTTA TGG Intergenic