ID: 991130890

View in Genome Browser
Species Human (GRCh38)
Location 5:63121290-63121312
Sequence GACCCCTGGAGTGCAGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991130880_991130890 25 Left 991130880 5:63121242-63121264 CCAAACAGGTGCCAACTGGAGGT No data
Right 991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG No data
991130881_991130890 14 Left 991130881 5:63121253-63121275 CCAACTGGAGGTAGTTCCCATTT No data
Right 991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG No data
991130883_991130890 -2 Left 991130883 5:63121269-63121291 CCCATTTTCCAGAGGCCTCATGA No data
Right 991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG No data
991130884_991130890 -3 Left 991130884 5:63121270-63121292 CCATTTTCCAGAGGCCTCATGAC No data
Right 991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG No data
991130886_991130890 -10 Left 991130886 5:63121277-63121299 CCAGAGGCCTCATGACCCCTGGA No data
Right 991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991130890 Original CRISPR GACCCCTGGAGTGCAGGGAG TGG Intergenic
No off target data available for this crispr