ID: 991132673

View in Genome Browser
Species Human (GRCh38)
Location 5:63142372-63142394
Sequence TATAGAGGGTTCAGTACTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991132673_991132679 26 Left 991132673 5:63142372-63142394 CCAATAGTACTGAACCCTCTATA No data
Right 991132679 5:63142421-63142443 CTCACTACTCTTGTGCTTTGGGG No data
991132673_991132678 25 Left 991132673 5:63142372-63142394 CCAATAGTACTGAACCCTCTATA No data
Right 991132678 5:63142420-63142442 TCTCACTACTCTTGTGCTTTGGG No data
991132673_991132677 24 Left 991132673 5:63142372-63142394 CCAATAGTACTGAACCCTCTATA No data
Right 991132677 5:63142419-63142441 ATCTCACTACTCTTGTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991132673 Original CRISPR TATAGAGGGTTCAGTACTAT TGG (reversed) Intergenic
No off target data available for this crispr