ID: 991133405

View in Genome Browser
Species Human (GRCh38)
Location 5:63153050-63153072
Sequence TTCCACGGGGTGGTGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991133405_991133414 -1 Left 991133405 5:63153050-63153072 CCTCATGACACCACCCCGTGGAA No data
Right 991133414 5:63153072-63153094 AAATGGAGCTTGGGGAAAAATGG No data
991133405_991133412 -9 Left 991133405 5:63153050-63153072 CCTCATGACACCACCCCGTGGAA No data
Right 991133412 5:63153064-63153086 CCCGTGGAAAATGGAGCTTGGGG No data
991133405_991133410 -10 Left 991133405 5:63153050-63153072 CCTCATGACACCACCCCGTGGAA No data
Right 991133410 5:63153063-63153085 CCCCGTGGAAAATGGAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991133405 Original CRISPR TTCCACGGGGTGGTGTCATG AGG (reversed) Intergenic
No off target data available for this crispr