ID: 991135261

View in Genome Browser
Species Human (GRCh38)
Location 5:63175754-63175776
Sequence GTGGAAGCTAGGCAATATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991135261_991135271 28 Left 991135261 5:63175754-63175776 CCACTATATTGCCTAGCTTCCAC No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data
991135261_991135268 10 Left 991135261 5:63175754-63175776 CCACTATATTGCCTAGCTTCCAC No data
Right 991135268 5:63175787-63175809 TCATGAGTCCAAGGGTAGCAAGG No data
991135261_991135265 1 Left 991135261 5:63175754-63175776 CCACTATATTGCCTAGCTTCCAC No data
Right 991135265 5:63175778-63175800 TAAATACCTTCATGAGTCCAAGG No data
991135261_991135269 11 Left 991135261 5:63175754-63175776 CCACTATATTGCCTAGCTTCCAC No data
Right 991135269 5:63175788-63175810 CATGAGTCCAAGGGTAGCAAGGG No data
991135261_991135266 2 Left 991135261 5:63175754-63175776 CCACTATATTGCCTAGCTTCCAC No data
Right 991135266 5:63175779-63175801 AAATACCTTCATGAGTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991135261 Original CRISPR GTGGAAGCTAGGCAATATAG TGG (reversed) Intergenic
No off target data available for this crispr