ID: 991135262

View in Genome Browser
Species Human (GRCh38)
Location 5:63175765-63175787
Sequence AAGGTATTTAGGTGGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991135262_991135268 -1 Left 991135262 5:63175765-63175787 CCTAGCTTCCACCTAAATACCTT No data
Right 991135268 5:63175787-63175809 TCATGAGTCCAAGGGTAGCAAGG No data
991135262_991135265 -10 Left 991135262 5:63175765-63175787 CCTAGCTTCCACCTAAATACCTT No data
Right 991135265 5:63175778-63175800 TAAATACCTTCATGAGTCCAAGG No data
991135262_991135271 17 Left 991135262 5:63175765-63175787 CCTAGCTTCCACCTAAATACCTT No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data
991135262_991135273 24 Left 991135262 5:63175765-63175787 CCTAGCTTCCACCTAAATACCTT No data
Right 991135273 5:63175812-63175834 ATTTCCAGTGCAGAGGCAATGGG No data
991135262_991135272 23 Left 991135262 5:63175765-63175787 CCTAGCTTCCACCTAAATACCTT No data
Right 991135272 5:63175811-63175833 TATTTCCAGTGCAGAGGCAATGG No data
991135262_991135266 -9 Left 991135262 5:63175765-63175787 CCTAGCTTCCACCTAAATACCTT No data
Right 991135266 5:63175779-63175801 AAATACCTTCATGAGTCCAAGGG No data
991135262_991135269 0 Left 991135262 5:63175765-63175787 CCTAGCTTCCACCTAAATACCTT No data
Right 991135269 5:63175788-63175810 CATGAGTCCAAGGGTAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991135262 Original CRISPR AAGGTATTTAGGTGGAAGCT AGG (reversed) Intergenic
No off target data available for this crispr