ID: 991135263

View in Genome Browser
Species Human (GRCh38)
Location 5:63175773-63175795
Sequence GACTCATGAAGGTATTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991135263_991135272 15 Left 991135263 5:63175773-63175795 CCACCTAAATACCTTCATGAGTC No data
Right 991135272 5:63175811-63175833 TATTTCCAGTGCAGAGGCAATGG No data
991135263_991135275 24 Left 991135263 5:63175773-63175795 CCACCTAAATACCTTCATGAGTC No data
Right 991135275 5:63175820-63175842 TGCAGAGGCAATGGGCAGTGAGG No data
991135263_991135273 16 Left 991135263 5:63175773-63175795 CCACCTAAATACCTTCATGAGTC No data
Right 991135273 5:63175812-63175834 ATTTCCAGTGCAGAGGCAATGGG No data
991135263_991135269 -8 Left 991135263 5:63175773-63175795 CCACCTAAATACCTTCATGAGTC No data
Right 991135269 5:63175788-63175810 CATGAGTCCAAGGGTAGCAAGGG No data
991135263_991135268 -9 Left 991135263 5:63175773-63175795 CCACCTAAATACCTTCATGAGTC No data
Right 991135268 5:63175787-63175809 TCATGAGTCCAAGGGTAGCAAGG No data
991135263_991135271 9 Left 991135263 5:63175773-63175795 CCACCTAAATACCTTCATGAGTC No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991135263 Original CRISPR GACTCATGAAGGTATTTAGG TGG (reversed) Intergenic
No off target data available for this crispr