ID: 991135264

View in Genome Browser
Species Human (GRCh38)
Location 5:63175776-63175798
Sequence TTGGACTCATGAAGGTATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991135264_991135275 21 Left 991135264 5:63175776-63175798 CCTAAATACCTTCATGAGTCCAA No data
Right 991135275 5:63175820-63175842 TGCAGAGGCAATGGGCAGTGAGG No data
991135264_991135271 6 Left 991135264 5:63175776-63175798 CCTAAATACCTTCATGAGTCCAA No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data
991135264_991135276 28 Left 991135264 5:63175776-63175798 CCTAAATACCTTCATGAGTCCAA No data
Right 991135276 5:63175827-63175849 GCAATGGGCAGTGAGGCTTTTGG No data
991135264_991135272 12 Left 991135264 5:63175776-63175798 CCTAAATACCTTCATGAGTCCAA No data
Right 991135272 5:63175811-63175833 TATTTCCAGTGCAGAGGCAATGG No data
991135264_991135273 13 Left 991135264 5:63175776-63175798 CCTAAATACCTTCATGAGTCCAA No data
Right 991135273 5:63175812-63175834 ATTTCCAGTGCAGAGGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991135264 Original CRISPR TTGGACTCATGAAGGTATTT AGG (reversed) Intergenic
No off target data available for this crispr