ID: 991135271

View in Genome Browser
Species Human (GRCh38)
Location 5:63175805-63175827
Sequence CAAGGGTATTTCCAGTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991135260_991135271 29 Left 991135260 5:63175753-63175775 CCCACTATATTGCCTAGCTTCCA No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data
991135262_991135271 17 Left 991135262 5:63175765-63175787 CCTAGCTTCCACCTAAATACCTT No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data
991135267_991135271 -2 Left 991135267 5:63175784-63175806 CCTTCATGAGTCCAAGGGTAGCA No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data
991135263_991135271 9 Left 991135263 5:63175773-63175795 CCACCTAAATACCTTCATGAGTC No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data
991135264_991135271 6 Left 991135264 5:63175776-63175798 CCTAAATACCTTCATGAGTCCAA No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data
991135261_991135271 28 Left 991135261 5:63175754-63175776 CCACTATATTGCCTAGCTTCCAC No data
Right 991135271 5:63175805-63175827 CAAGGGTATTTCCAGTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991135271 Original CRISPR CAAGGGTATTTCCAGTGCAG AGG Intergenic
No off target data available for this crispr