ID: 991138240

View in Genome Browser
Species Human (GRCh38)
Location 5:63208580-63208602
Sequence GAAGAATCCTAGAACCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991138232_991138240 17 Left 991138232 5:63208540-63208562 CCTGATTAAAGTCCACTGTGAGG No data
Right 991138240 5:63208580-63208602 GAAGAATCCTAGAACCTGCAGGG No data
991138231_991138240 23 Left 991138231 5:63208534-63208556 CCATGACCTGATTAAAGTCCACT No data
Right 991138240 5:63208580-63208602 GAAGAATCCTAGAACCTGCAGGG No data
991138229_991138240 30 Left 991138229 5:63208527-63208549 CCCTGTGCCATGACCTGATTAAA No data
Right 991138240 5:63208580-63208602 GAAGAATCCTAGAACCTGCAGGG No data
991138230_991138240 29 Left 991138230 5:63208528-63208550 CCTGTGCCATGACCTGATTAAAG No data
Right 991138240 5:63208580-63208602 GAAGAATCCTAGAACCTGCAGGG No data
991138234_991138240 5 Left 991138234 5:63208552-63208574 CCACTGTGAGGCATGTCCTTCCA No data
Right 991138240 5:63208580-63208602 GAAGAATCCTAGAACCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991138240 Original CRISPR GAAGAATCCTAGAACCTGCA GGG Intergenic
No off target data available for this crispr