ID: 991144212

View in Genome Browser
Species Human (GRCh38)
Location 5:63282262-63282284
Sequence ATTCTGAGCAGACTATAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991144212_991144214 12 Left 991144212 5:63282262-63282284 CCTCGTTATAGTCTGCTCAGAAT No data
Right 991144214 5:63282297-63282319 CTTTATCCATGTCCCTGCAAAGG 0: 235
1: 6181
2: 14155
3: 17675
4: 7183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991144212 Original CRISPR ATTCTGAGCAGACTATAACG AGG (reversed) Intergenic
No off target data available for this crispr